Weights Tenders from India

656 Weights tenders are published by various Tendering Authorities & Private companies. 656 live Tender for Weights are available in Weights Tender section You can further filter Weights tenders by Tender Value, Tender Submission Date or Project Location.

1

Government Departments - Malappuram - Kerala

45970708 tender for supply of lab equipment for the course fitness trainer in skill development center at government vocational higher secondary school, malappuram district. 1 dumbbel 2 dumbbel 5 3 dumbbel 7 4 dumbbel 1 5 dumbbel 6 dumbbel 7 kettlebell 8 kettlebell 9 jolympic weights plates 10 olympic weights plates 11 olympic weights plates 12 olympic weights plates 13 commercial medicine ball 14 portable adjustable gim stool 15 barbell collar 16 dumbell weight stand 17 olympic rod 18 olympic rod 19 o...

Due Date : Nov 4, 2024
Tender Value : Ref. Document
View Notice
2

Statutory Bodies & Commissions/Committees - Prayagraj - Uttar Pradesh

45968368 bids are invited for k6 7330-000077 uc 45 mset deg 280 mm lid , k6 7330- 000061 uc 4 mset parat small , k6 7330-000060 uc 4 mset parat med , a4 6530-000020 stretcher folding light weight trestles , k4 7350-000020 pot tea 1.14 litre pot tea 600 ml , k3 7210-000049 sheet baby , k1 7125-000041 cabinet storage meat milk mk-ii , k6 7330-000245 container milk almn 20 ltr deliv type total quantity : 786

Due Date : Nov 19, 2024
Tender Value : Ref. Document
View Notice
3

Government Departments - visakhapatnam - Andhra Pradesh

45968327 supply of procurement of fixed displacement motor, simplex chain, drive sprocket etc., for the use of track machine.procurement of fixed displacement motor, simplex chain, drive sprocket etc., for the use of track machine.,fixed displacement motor (drive motor) as per simplex part no. c100000113-6000 pos 3 or 6192-250-03-00-b and hydro leduc part no. m41 a w1 lo m2 00 sv f, make - simplex,hydro leduc o r its equivalent. ] , fixed displacement motor (drive motor) as per simplex part no. c1000001...

Due Date : Nov 27, 2024
Tender Value : Ref. Document
View Notice
4

Statutory Bodies & Commissions/Committees - FIROZABAD - Uttar Pradesh

45968257 bids are invited for fabric nylon light weight 37 gsm 94 cms. wide total quantity : 18994

Due Date : Oct 31, 2024
Tender Value : Ref. Document
View Notice
5

Government Departments - Kanpur - Uttar Pradesh

45968214 tender for the area of ​​power distribution division-i, kanpur, m/s psit higher education araji no. 494, 547, nh-2 bhiti, kanpur city connection no. 4682455000 load 1000 kva (hv-1) industrial vidya which is connected from 33/11 kv power substation sachendi. the output is fed from 11 kv bansal feeder and the work of connecting it to an independent feeder.:- work of issuing electrical connections of 310 kv weight for ev charging station in agra lucknow expressway village gujepur village, araul ka...

Due Date : Nov 13, 2024
Tender Value : Ref. Document
View Notice
6

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

45967997 bids are invited for portable electric angle grinders 125 mm with standard equipments of the following specification input power 1400 watt no load rpm- 11000 wheel dia 125 mm v-220/235 v weight 2.2 kgs (approx), with two pair carbon brush make- bosch, kpt,hitachi or equivalent. total quantity : 10

Due Date : Nov 19, 2024
Tender Value : Ref. Document
View Notice
7

Local Bodies - ujjain - Madhya Pradesh

45967980 supply of health material -1 apron jacket 120 gsm super quality, nagar palika nigam mono tattoo to be printed on the jacket 2 broom hand skewer 600 grams 4 feet long 3 spade (tata company) weight approx 1.040 kg 9”×8” plate length/width 4 pickaxe, weight approx 3.070 kg 5 iron spade, weight 2.200 kg (7×7 inch plate) iron 7 feet long in 1.5 inches 6 crowbar, approx 6.500 kg (5 feet 5 inches long) 7 small iron basket approx 1.600 kg in glazed sheet 8 big iron basket approx 2.400 kg in glazed she...

Due Date : Nov 12, 2024
Tender Value : rupee 30 Lakhs
View Notice
8

Government Departments - Jaipur - Rajasthan

45967969 electrical work in construction of temporary light weight structure in the vacant space lying near second floor at banipark, jaipur metro-i.

Due Date : Nov 1, 2024
Tender Value : rupee 1.16 Lakhs
View Notice
9

Government Departments - raipur - Chhattisgarh

45967741 supply of 1) digital wheel diameter gauge with lcd display. measuring accuracy : +/- 0.02 mm, least count : 0.01 mm, measuring range : 780-1050 mm., wheel contact point to be made of carbide, lighter in weight. calibration certificate from nabl/govt. approved lab is needed. to be preferably supplied in storing box with carrying handle. make : paragon/jyoti/ganapathy/prasad/equivalent reputed firm. material required at c&w/bia. 2) digital wheel diameter gauge with lcd display. measuring accuracy...

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
10

Government Departments - bhopal - Madhya Pradesh

45967660 supply of tennis goods 2024 4th call e tender for tennis goods and equipment 2024 4th call , tennis goods , tennis shoes (non-making) , tennis kit bag (1.kit bag06 packsports kit bag with shoulder strap, capacity to hold 06 rackets, large accessory pocket to holdequipment like water bottle and ball, large compartment to holdshoes and apparel, made up of heavy duty material for strength) , tennis kit bag (2. sports kit bag with shoulder strap, capacity to hold 12 rackets, small accessory pocket ...

Due Date : Nov 7, 2024
Tender Value : rupee 50 Lakhs
View Notice
11

Boards / Undertakings / PSU - Prayagraj - Uttar Pradesh

45967470 auction sale of disposal of mentioned items - lummer bradhum photometer lummer bradhum photometer phols commutator phols commutator lummer bradhum photometer lummer bradhum photometer galvanometer galvanometer constant water level head lummer bradhum photometer galvanometer galvanometer plate holder phols commutator physical balance physical balance physical balance moving coil suspended type dead beat galvanometer with lamp and scale etc. earth inductor earth inductor newton law of cooling app...

Due Date : Nov 19, 2024
Tender Value : Ref. Document
View Notice
12

Local Bodies - hyderabad - Telangana

45966820 tender for 5) supply and installation of various telangana festival sculptures casted with brass material, welding finishing and with suitable painting, total 8 nos each of weight 200kgs including cost and conveyance ol materials and installation charges for completion of work excluding gst of 18%.

Due Date : Nov 1, 2024
Tender Value : Ref. Document
View Notice
13

Local Bodies - hyderabad - Telangana

45966795 tender for 3) supply and installation of 3d musical instruments sculptures 2 pieces with a height of 4 feet casted with brass material, welding finishing and with suitable painrng with the weight of 250kg each including cost and conveyance of all the materials for installation and installation charges for completion of work excluding gst 0(18%. 4) supply and installation of saregamapa symbol with a size of 18 feet height and width of 30 feet with weight of 3000 kgs, made of mild steel w...

Due Date : Nov 1, 2024
Tender Value : Ref. Document
View Notice
14

Local Bodies - hyderabad - Telangana

45966668 tender for supply and installation of radha krishna sculptures of 2 pieces with a height of 6.5 feet, casted with brass material, welding finishing and with suitable painting each of weight 200kgs including cost and conveyance of all the materials for installation and installation charges for dompletion of work excluding gst of 18%. 2) supply and installation of musician batch with musical instruments• sculpture. 6 pieces with a height of 3.5 feet with the weight of 25okgs each, casted ...

Due Date : Nov 1, 2024
Tender Value : Ref. Document
View Notice
15

Government Departments - Dehradun - Uttarakhand

45966614 bids are invited for buy back - lead acid batteries for motor vehicles with light weight and high cranking performance (v2) (q3) total quantity : 4

Due Date : Nov 8, 2024
Tender Value : Ref. Document
View Notice
16

Boards / Undertakings / PSU - Jaipur - Rajasthan

45966543 ebid for drip automation and sprinkler-related items, plastic water tanks etc.-l. complete set of automation irrigation unit:- specification of the machine with following facility:- a. time based and volume irrigation facility with loaded software programmable as per crop need. b. facility for monitoring, record keeping and data analysis for water budgeting. c. monitoring of ph and ec of irrigation water and ph correction facility. d. one dosing channel with rotameter having leum flow per hr. e...

Due Date : Nov 25, 2024
Tender Value : rupee 25 Lakhs
View Notice
17

Statutory Bodies & Commissions/Committees - Ernakulam - Kerala

45966101 bids are invited for stair climber , incline decline bench , ab board , callisthenics station , utility stool , adjustable weight vest , vinyl dipped kettle bell 2 kg , vinyl dipped kettle bell 4 kg , vinyl dipped kettle bell 6 kg , vinyl dipped kettle bell 8 kg , vinyl dipped kettle bell 10 kg , vinyl dipped kettle bell 12 kg , vinyl dipped kettle bell 14 kg , vinyl dipped kettle bell 16 kg , vinyl dumbbell 2 kg , vinyl dumbbell 3 kg , vinyl dumbbell 4 kg , dip belt , mag grip set of 5 , comme...

Due Date : Oct 30, 2024
Tender Value : Ref. Document
View Notice
18

Boards / Undertakings / PSU - Udaipur - Rajasthan

45965867 tender for stationery items & other items - white paper 43 x 69 cms., 8.5 kgs 60 gsm photo copier paper 70 gsm size:- a -4 size photo copier paper 70 gsm size:-legel size punching machine full size d.p. 800 punching machine full size d.p. 600 carbon paper blue/black, superior quality 44.5 x 57 cms file pads 23 x 36 cms tags 8 size file laces green 9 x24 all pins common (100 grms) stapler machine hp 45 stapler machine no. 10 stapler pins- big size stapler pins small size stamp pads big (red &...

Due Date : Nov 8, 2024
Tender Value : rupee 30 Lakhs
View Notice
19

Local Bodies - prayagraj - Uttar Pradesh

45965770 supply of sanitation equipment in prayagraj municipal corporation under mahakumbh mela 2025-2 hand garbage cart (ms) 3 spade with handle (3 mm thick sheet 20 x 14 cm, handle: babool/sheesham) 4 pancha with handle (20x14 cm, weight 1 kg, handle: babool/sheesham ) 5 basket cane (18” x 8”) 6 basket plastic (isi) 7 gaita with handle (standard size) 8 belcha (standard size) 9 hasia jhabau (90 cm long) 10 aankdi big (5’ long) 11 aankdi small (5’ long) 12 bamboo broom (with solid handle) 13...

Due Date : Nov 12, 2024
Tender Value : Ref. Document
View Notice
20

Statutory Bodies & Commissions/Committees - Bareilly - Uttar Pradesh

45965373 bids are invited for cable cross 100 x 2 kg , smith machine , leg curl leg extension , flat bench , pec fly rear delt 220 lbs , dual twister , multi adjustable bench , lat pull down seated row , olympic rod ez curl , olympic rod 4ft , olympic rod 5 ft , olympic rod set 7ft , tricep rod , weight plate 5 kg 6 pcs , weight plate 7.5 kg 4 pcs , weight plate 10 kg 4 pcs , weight plate 15 kg 2 pcs , bamboo , dumbbell 5 kg 2 pair , dumbbell 10 kg 3 pair , dumbbell15 kg 2 pair , dumbbell 20 kg 1 pair ,...

Due Date : Oct 30, 2024
Tender Value : Ref. Document
View Notice
21

Statutory Bodies & Commissions/Committees - Dehradun - Uttarakhand

45965016 bids are invited for drive belt , spark plug , bearing ball seal , brake pad , brake pad rear , wheel stud , scr hh 3 by 8 16into0.75 grs zy3 , nut-flange,two piece , ignition coil , weight- shift,25-52g,pm , spring-clutch, 35-240 , oil filter , air filter total quantity : 64

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
22

Statutory Bodies & Commissions/Committees - Ranga Reddy - Telangana

45964881 bids are invited for universal canister , methyl bromide tlv detector tubes , phosphine tlv detector tubes , oat meal agar , zapex dox agar , tetrazolium chloride agar , potato dextrose broth , bacterial biochemical identification kit , finger manifold , canvas sand bags , arginine chemical , ethanol , absorbent cotton , non absorbent cotton , needles , standard germination paper gsm-145 , iodine liquid , digital moisture meter , bacterial loops with needle 1 loop,50 needles , mercury ink therm...

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
23

Government Departments - Choondal - Kerala

45964135 tender for delivery of materials for various types of work in quantity and quantity included in the year. quarry waste stone aggregate(single size): 40 mm nominal size stone aggregateļsingle size):20 mm nominal size stone aggregate(single size): 10 mm nominal size coarse sand (zone iii) portland cement. twisted steel/deformed bars solid block of size 30x20x15 cm pvc pipe 63 mm outer dia 4kgf/cm2 common burnt clay f.p.s. (non modular bricks class designation 7.5 fine sand pvc bend 63mm dia pvc ...

Due Date : Nov 6, 2024
Tender Value : Ref. Document
View Notice
24

Government Departments - Thiruvananthapuram - Kerala

45963457 tender for supply of dental assistant stool , dental assistants stool-1. should be made of pu leather or micro fibre leather, high density rebound foam inside, and superior injection plastic board underneath to offer you perfect and comfortable support. 2. should have ergonomic design that fits back curve. 3. should have adjustable heightfrom18.9to23.2androtate 360 degrees the armrest/backrest. 4. should have five-star sturdy base with durable swiveling wheels. 5. stool: single lever adjustment...

Due Date : Nov 8, 2024
Tender Value : rupee 7440.0
View Notice
25

Government Departments - Asansol - West Bengal

45962738 supply of procurement of smoke gunprocurement of smoke gun,smoke gun: supply and delivery of smoke gun which is made of stainless-steel body inside- outside both. weight of the product is 1.13 kilogram. the product will be operated with 4 nos of battery. s moke gun will be supplied as a complete product with batteries, replacement smoke screen, sample wood chips and instructions manual. this product will have integrated stand for comfortable use, 17.5 inch exten der hoze for precise smoke place...

Due Date : Nov 21, 2024
Tender Value : Ref. Document
View Notice
26

Local Bodies - mongalkote - West Bengal

45962615 tender for 10 nos. black bengal does(age not less than 9 months and body weight 9 kg and above)

Due Date : Nov 7, 2024
Tender Value : rupee 3.60 Lakhs
View Notice
27

Government Departments - srinagar - Jammu And Kashmir

45962556 supply, installation, testing and commissioning of electrical and mechanical supply, installation, testing and commissioning of electrical and mechanical equipments at w.s.s. chewa pehlipora 2nd, ganderbal under jjm - supply, installation, testing & commissioning of vertical type submersible pumping unit as per 8034[2002] for pumping water from filtered collection sump. the specification are as under: pump: -discharge= 20000 gph head = 190 mtrsspeed =2900 rpm type of pump =mixed flow. type of f...

Due Date : Nov 4, 2024
Tender Value : rupee 6.31 Lakhs
View Notice
28

Government Departments - Bhubaneswar - Odisha

45960330 supply of smoking gun pro hand held smoke infuser.smoking gun pro hand held smoke infuser.,smoking gun pro hand held smoke infuser (black), battery operated inner and outer m aterial stainless steel, item dimension (l x w x h) = 7 x 7 x 10 cm. weight = 1.13 kg (approx), make - breville or similar. [ warranty period: 30 months after the date of delivery ] ] => limited

Due Date : Nov 6, 2024
Tender Value : Ref. Document
View Notice
29

Government Departments - bhilai - Chhattisgarh

45960080 supply of hydraulic lifting bottle jack.hydraulic lifting bottle jack.,hydraulic lifting bottle jack, 30 ton capacity along with washer kit. jack height 265 mm, ma ximum height 430 mm and lifting height 150 mm, weight 13 kgs. make: orient / bemco hytech / power te am / vankos / duff-noron / penta / groz or similar along with warranty certificate. [ warranty period: 30 months after the date of delivery ] [quantity tolerance (+/-): 5 %age , item category : normal , total po value variation permit...

Due Date : Nov 11, 2024
Tender Value : Ref. Document
View Notice
30

Government Departments - howrah - West Bengal

45960014 supply of tan delta kit.tan delta kit.,tan delta kit, with supply of one number laptop with latest specification preloaded ms-win dow 11 professional or better with latest version of application software required for storage, analysis and r ecord management, input power-100-240 v ac, 50 hz, output voltage-0 to 12 kv continuously adjustable, output power-3.6 kva, output frequency-1-505 hz, test frequency range- 45-70 hz(12 kv) 15-400 hz (4 k v) 1-505 hz (250v), output current-300ma(4 minutes), 1...

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - Ballia - Uttar Pradesh

45959483 bids are invited for weight indicator (q3) total quantity : 1

Due Date : Nov 7, 2024
Tender Value : Ref. Document
View Notice
32

Boards / Undertakings / PSU - Ghaziabad - Uttar Pradesh

45959316 bids are invited for mass flow meter mass flow meter 150 series flow range 55 to 275 kl per hr , mass flow meter 150 series flow range 250 to 1050 kl per hr , flow transmitter spare , commissioning and supervision for installation , calibration of mass flow meter at fcri palakkad or any nabl accredited laboratory , stamping charges from weights and measures department total quantity : 109

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
33

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

45959243 bids are invited for plain copier paper (v2) as per is 14490 (q4) , transparent tape (v2) (q4) , glue stick (v2) (q4) , eraser (q4) , file folder cover (v2) (q4) , staplers (v2) (q3) , roller ball pen (v2) (q4) , glass cleaner, liquid (v2) as per is 8540 (q4) , cleaning duster (v2) (q4) , diaries printed - plain - register (q4) , read write compact disc cd (q4) , correspondence envelopes (v2) (q4) , binder clips (v2) (q3) , fluid correction pen (v2) (q4) , clips, paper as per is 5650 (q4) , pap...

Due Date : Oct 31, 2024
Tender Value : Ref. Document
View Notice
34

Government Departments - Kozhikode - Kerala

45959186 tender for supply of items indoor soft play rugs 12mm thickness.size 60 cm length, width 60cm.child friendly attractive lite weight and durable. kidney table: color full and attractive table with minimum size of length 135 centimeters, width 75 cm and height 50cm with strong 4 legs, fully detachable legs and anti skid rubber bush attached simple portable.activity table top should be fine and smooth no sharp edges, multi colors students study material full protected edge on the top of the tabl...

Due Date : Nov 15, 2024
Tender Value : Ref. Document
View Notice
35

Statutory Bodies & Commissions/Committees - Medchal Malkajgiri - Telangana

45959020 bids are invited for procurement of consumables mse loctite 242 50ml , loctite 222 50ml , loctite 270 50ml , loctite si 596 flange sealant 85gm tube , high vacuum grease 150gm tube , araldite standard 180gms pack , tef gel tg 16 ptfe paste corrosion eliminator anti seize lubricator weight , lubricant mc 1210 extended life extreme heavy duty grease , pvc wrapping roll width 300mm, thickness min 20microns , liquid leak detector or snoop liquid bottle 8 oz , gloves nitrile powder free. length 12 i...

Due Date : Nov 7, 2024
Tender Value : Ref. Document
View Notice
36

Statutory Bodies & Commissions/Committees - Jalgaon - Maharashtra

45959005 bids are invited for steel insert for ak-47 bullets steel insert for ak-47 bullets is:1570 (part-ii) 1979/40c8 (reaffirmed 2016)/40c8. or bs:970 part-i 080-m40/709 m40 hardness :- vpn 450 - 600.oil blackened/oil dipped drg.no: va7/prov/0009 a note: weight of steel core is 3.19 grams to 3.27 grams i.e. 3.23(+/-0.04) grams total quantity : 16874

Due Date : Nov 16, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - Mumbai Suburban - Maharashtra

45958842 bids are invited for general items 1 300021415 alloy steel stud with two hexagonal nuts, fully threaded size: 5/8 x 4 long, threads: as per unc class 2a conforms to asa b18.2.1 for stud, unc class 2b conforms to asa b18.2.2 for nut, moc stud: a193 gr b7, nut: a 194 gr 2h. offer make: hsn: 450 no 2 300021425 alloy steel stud with two hexagonal nuts, fully threaded size: 3/4 x 4-1/2 long, threads: as per unc class 2a conforms to asa b18.2.1 for stud, unc class 2b conforms to asa b18.2.2 for nut...

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
38

Statutory Bodies & Commissions/Committees - jamnagar - Gujarat

45958463 special repairs to street light timer panel with other connected items and special repairs/ replacement of bedi water supply lines at certain location at ins valsura, jamnagar - excavating in trenches, not exc 1.5 metre wide and not exc 1.5 metre in depth, for foundation, etc. or for shafts, wells, cesspits, manholes, pier holes, etc. laying cables, pipes, etc. not exc 10 sqm on plan & not exc 1.5m in depth and getting out in soft/ loose soil complete all as specified and as directed. 2 return...

Due Date : Nov 16, 2024
Tender Value : rupee 48.96 Lakhs
View Notice
39

Statutory Bodies & Commissions/Committees - delhi - Delhi

45958408 procurement of spares for mi-17v5 helicopter , protective blanking cover , ring , ring , gasket , ring , cap , cap , nut , hose , cylindrical roller , ring , filtering element , ring , spring , sleeve , ring , door , hose(rubber) , lock washer , socket , plug , ring , ring , ring , grease packing gland , clutch , drive shaft to intermediate gearbox attachment bolt , plate , plate , plate , plate , bearing , bearing , nut , drive shaft to intermediate gearbox attachment nut , nut , hose , hose 3...

Due Date : Jan 21, 2025
Tender Value : Ref. Document
View Notice
40

Local Bodies - VIZIANAGARAM - Andhra Pradesh

45958286 construction of weight lifting gym building in the premises of sainik school at korukonda in vizianagaram district

Due Date : Nov 12, 2024
Tender Value : rupee 54.72 Lakhs
View Notice
41

Statutory Bodies & Commissions/Committees - Ludhiana - Punjab

45958038 provision of certain sanctioned b/r and e/m works at dholewal, cg complex and baddowal under ge ludhiana. - demolition of cement concrete (unreinforced) of any description and in any position not otherwise specifically provided complete all as specified & directe and removing rubbish off the premises. 3 dismantling brick tiles or terracing tiles single layer including any treatment on roofs complete all as specified & directed. 4 demolition of mud in roofs any thickness including plastering a...

Due Date : Nov 18, 2024
Tender Value : rupee 21.34 Lakhs
View Notice
42

Government Departments - Jodhpur - Rajasthan

45957479 annual rate contract for electric items under jurisdiction of pwd elect division ii jodhpur (half yearly basis)-s&f following sizes (dia.) of isi marked virgin material mms (is:9537 p-iii) pvc conduit along with isi marked (is-3419-1988) accessories qiah own oem cm/l no as required in recess including cutting the wall, covering conduit and making good the same as required. for additional technical parameters of product / work refer annexure a attached with this bsr 20 25mm 32mm p & f 1.2mm thic...

Due Date : Nov 7, 2024
Tender Value : rupee 14.98 Lakhs
View Notice
43

Government Departments - ernakulam - Kerala

45956690 e -tender for the furnishing work at ernakulam- 1 e -tender for the furnishing work at ernakulamfor more details refer tender documents 2 12.45.3 providing and fixing false ceiling at all height including providing and fixing of frame work made of special sections, power pressed from m.s. sheets and galvanized with zinc coating of 120 gms/ sqm (both side inclusive) as per is : 277 and consisting of angle cleats of size 25 mm wide x 1.6 mm thick with flanges of 27 mm and 37 mm, at 1200 mm cent...

Due Date : Nov 12, 2024
Tender Value : rupee 68.34 Lakhs
View Notice
44

Government Departments - Mumbai - Maharashtra

45955944 bids are invited for consumables for medical research a1780 rabbit pab 20ul , a2416 isg15 rabbit mab 20ul , a8271 rsad2 rabbit pab 20ul , p 8920 poly l lysine solution 0.1percent weight by volume in h2o , mm-gapdh-f aactttggcattgtggaagg hplc grade , mm-gapdh-r ggatgcagggatgatgttct hplc grade , mm-actb-f tgttaccaactgggacgaca hplc grade , mm-actb-r ggggtgttgaaggtctcaaa hplc grade , mm-18s rrna-f gtaacccgttgaaccccatt hplc grade , mm-18s rrna-r ccatccaatcggtagtagcg hplc grade , mm-h2ac21-f1 gagctca...

Due Date : Nov 18, 2024
Tender Value : rupee 1.25 Lakhs
View Notice
45

Government Departments - kaithal - Haryana

45955781 annual repair of nirman sadan at kaithal in kaithal distt. for the year 2024-25 - 1 [11.4.2]10 mm thick cement plaster 2. 1:3 (1 cement: 3 fine sand) 2 [11.5.4]12 mm cement plaster of mix : 4. 1:6 (1 cement: 6 fine sand) 3 [11.58]providing and applying two coats white cement based putty of approved brand and manufacturer, over plastered surface and grinding the surface smooth with sand paper to get en even and smooth finish including cost and carriage of all material , labour charges, scaffo...

Due Date : Nov 4, 2024
Tender Value : rupee 4.19 Lakhs
View Notice
46

Statutory Bodies & Commissions/Committees - Visakhapatnam - Andhra Pradesh

45954570 bids are invited for ball pens blue , ball pens black , ball pens red and green , pencil , file covers with nstl logo , box files , dvd rw , correction pen , plastic folder a4 size , glue stick , notesheet book green , stapler machine small , stapler machine big , stapler pins small , scissors , aa batteries , aaa batteries , cd marker , permenent marker , white board marker , stick on pad three in one , stick note big , binder clip small , binder clip medium , paper weight , cello tap 1 inch ,...

Due Date : Oct 30, 2024
Tender Value : Ref. Document
View Notice
47

Government Departments - Tripura - Tripura

45954520 e-tender(2nd call) for procurement of 50 nos of approx 31 to 35 liter capacity storage type biological cryocontainers with 6 canisters during the year 2024-2025 to be supplied to central semen collection station, radhakishore nagar, west tripura , approx. 31-35 liter capacity storage type biological liquid nitrogencryocan/ cryocontainer with 06 canisters--capacity liquid nitrogen(liters)-33 to 34 liters empty weight (kg)-14.5 to 14.6 kg.full weight(kg)-41.4 to 48.5 kg.neck diameter (mm)-51 mm. ...

Due Date : Nov 18, 2024
Tender Value : rupee 16 Lakhs
View Notice
48

Statutory Bodies & Commissions/Committees - Thane - Maharashtra

45954206 bids are invited for boq bid note book , scribbing pad , self stick , pen , scissors , gum , glue stick , stapler pin , file cover , gel pen , marker , eraser , ball pen , ink violet , tag , paper br craft , paper brown , pen ball , clip pad , paper weight , correcting tap , sharpner , pen stand , rope coir sutli , tap dispenser , ruled book 10 qr , brown tape , self stick pad 1 colour plastic , sketch pens , ring folder , milky folder , paper cutter , poker , lamination , brown paper roll , si...

Due Date : Nov 18, 2024
Tender Value : rupee 1.93 Lakhs
View Notice
49

Government Departments - Aurangabad - Bihar

45954202 tender for supply of civil engineering laboratory equipment government polytechnic aurangabad dhanari-aurangabad pin-824102-1 aggregate crushing value test 2 softening point test of bituminous material 3 flash and fire point test 4 shape test (flakiness index value test 5 shape test (elongation index value test) 6 ductility test 7 is sieve 8 specific gravity of bitumen by pycnometer method 9 steel measuring tape 10 weight balance machine 11 thermometer 12 glass beaker 13 pipette 14 stirrer. 15 ...

Due Date : Nov 18, 2024
Tender Value : rupee 18 Lakhs
View Notice
50

Government Departments - royapuram - Tamil Nadu

45953776 supply of papper printing maplitho white color in sheets of 58 x 91 cms, 70 gsmpapper printing maplitho white color in sheets of 58 x 91 cms, 70 gsm,papper printing maplitho white color in sheets of 58 x 91 cms, 70 gsm with tolerance of plus or minus 5 percent, minimum brightness 80% isi marked and conforming to is :1848/2007 with amendment no. 1 & 2. the paper should be manufactured out of pulp con taining not less than 60 percent by weight of pulp made from materials other than bamboo,hardwoo...

Due Date : Nov 7, 2024
Tender Value : Ref. Document
View Notice
51

Boards / Undertakings / PSU - Ramgarh - Jharkhand

45953555 annual maintenance contract including annual verification and stamping of 01 no. 60 mt electronic weighbridge , cleaning, testing and adjustment of 1000 nos. of 20 kg c.i. test weights and replacement of load cell for 1 year under religara project

Due Date : Nov 4, 2024
Tender Value : rupee 2.77 Lakhs
View Notice
52

Government Departments - Aurangabad - Bihar

45953381 supply of civil engineering laboratory equipments for consultancy work in the premises of government polytechnic aurangabad, at -dhanari aurangabad, bihar-824102-1 cylindrical moulds 2 cement tensile testing machine 3 tensile (briquette) testing machine 4 standard vicats apparatus 5 needle vibrator 6 weight hanger 7 automatic mortar mixer, digital capacity 5l 8 beam deflection apparatus structural lab 9 ultrasonic pulse velocity instrument 10 mixing pan or tray 11 core cutting machine wit...

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
53

Statutory Bodies & Commissions/Committees - gwalior - Madhya Pradesh

45953366 welcome maintenance of md accn map accn and connected items in the area of age b/r-ii under ge gwalior - dismantiling of stone slabs and tiles (kota stone etc) of any discription or any thickness in floors, aprons, skirting, dado etc laid bedded and pointed in any mortar complete all as specified and directed. dismantling floor, hearth or wall tiling of any description and in any position including cement mortar bedding (but not backing) complete all as specified and directed. demolition of...

Due Date : Nov 18, 2024
Tender Value : rupee 48 Lakhs
View Notice
54

Government Departments - Morbi - Gujarat

45953219 bids are invited for 1 high lighter grade retroreflective tape made of non metalized poly carbonate micro prismatic lenses visible from more than 1000 mts highly durable non corodable 7 years warranty are to confirmed compliance to asi specification size 4 width black make-3 m or similar 800 sqō sr. secɵon engineer/p.way /wkr 87245606 2 high lightr grade retroreflective tape made of non metalized poly carbonate micro prismatic lenses visible from more than 1000 mts highly durable non corodable...

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
55

Statutory Bodies & Commissions/Committees - Jodhpur - Rajasthan

45953032 bids are invited for stationary items as per sample colour , paper weight , paper pin t type , pen black ball make make cello , pen blue ball make make cello , pen red ball make make cello , pen blue gel make make uniball , pen red gel make make uniball , pen stand , pen v5 hitech point black , pen v5 hitech point blue , pencil , pencil bty aa size , pencil bty aaa size , photocopier paper a4 70 gsm , photocopier paper fs 70 gsm , pillow with cover , bed sheet for double bed , poker , register ...

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
56

Government Departments - Sundargarh - Odisha

45952348 bids are invited for weight cuffs (q3) total quantity : 351

Due Date : Nov 8, 2024
Tender Value : Ref. Document
View Notice
57

Statutory Bodies & Commissions/Committees - Mumbai Suburban - Maharashtra

45951479 bids are invited for tem no 1 (material code-18621116) tube copper 16mm od x 1point0mm thk bs 2817 part ii c106 in 1by2 h annealed condition item no 2 (material code-18603217) copper pipe size 20 standard bs 2871part ii by is 1545 2point0mm thk of table 3 c 106 standard length 6 mtrs plus or minus1 mtrs tolerance with mtc bearing heat marks on each length at one end with tracability to mtc both ends to be suitable blanked & surface preserved item no 3 (material code-18603218) copper pipe size ...

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
58

Government Departments - jaipur - Rajasthan

45949338 tender for transportation of tower material including toll charges, other way expenses and transit insurance from acos, jodhpur to 220kv gss, bikaner (270km) for approx. 23 mt material including loading, unloading, weighting and stacking 220kv d/c ttd-stub 220kv d/c ttd-superstructure 220kv d/c ttd +6m ext acsr zebra (54/3.18mm al+7/3.18mm steel) 120kn b&s disc insulator s/t h/w zebra d/t h/w zebra vibration damper-zebra g.i.earth wire 7/4 mm vibration damper -e/w 7/4.0 mm e/w 7/4.0mm (comp...

Due Date : Nov 5, 2024
Tender Value : rupee 46662.0
View Notice
59

Government Departments - coimbatore - Tamil Nadu

45948882 supply of counter weight a1counter weight a1,counter weight a1 to drg.no.cwm 00210 alt-2 ci, l= 430mm [ warranty period: 30 months after the date of delivery ] ] => limited

Due Date : Nov 8, 2024
Tender Value : Ref. Document
View Notice
60

Government Departments - Bhubaneswar - Odisha

45948866 supply of pneumatic random orbit sander.pneumatic random orbit sander.,pneumatic random orbit sander with dirt collector to following specific ations listed below: sanding pad diameter: 150 mm, input power: 210 w, weight: 0.82 kg+ /- 0.1 kg, sanding sheet/disc attachment: hook and loop fastening, free speed: 12000 rp m, warranty: 1 year, accessories:-(a) 6 inch backing pad with 6 holes-1 no, (b) 1/2 inch fi lter regulator lubricator frl- 1 no (c) 8 x 12 recoil pu hose 10 mtrs ? 2 nos (d) 1/4 in...

Due Date : Nov 8, 2024
Tender Value : Ref. Document
View Notice
61

Statutory Bodies & Commissions/Committees - Andaman - Andaman And Nicobar Islands

45948083 bids are invited for add gel pen black , add gel pen blue , add gel pen red , ball pen black , ball pen blue , ball pen red , binder clip large 41mm , binder clip large 32mm , binder clip small 21mm , brown sheet laminated , calculater , cello tape wonder 0.5 inch wide blue colour , cello tape wonder 0.5 inch wide red colour , cello tape wonder 0.5 inch wide green colour , computer cloth yellow , correcting pen , carbon paper kores , dura cell 1.5 volt size aa , dura cell 1.5 volt size aaa , du...

Due Date : Nov 18, 2024
Tender Value : rupee 12.52 Lakhs
View Notice
62

Statutory Bodies & Commissions/Committees - Andaman - Andaman And Nicobar Islands

45948072 bids are invited for ge mb calcium hypo chlorite , alum , led batten 20 w , led batten 10 w 2 ft , cable copper single core x 10 sq mm mutli strand , energy efficient led flood light fitting light fitting 250 watt , supply onl lime in dust form in best qualit suitable for treating raw water in 50 kg bag , energy efficient led street light fitting 90 watt , energy efficient led flood light fitting light fitting 200 watt , energy efficient led street light fitting 60 watt , energy efficient 40 w ...

Due Date : Nov 18, 2024
Tender Value : rupee 42.76 Lakhs
View Notice
63

Government Departments - kokrajhar - Assam

45947980 installation of 20 nos. desktop computers lab. and etc. at girls college, kokrajhar in kokrajhar district installation of 20 nos. desktop computers lab. etc. at girls college, kokrajhar in kokrajhar district , interactive flat panel 75”: black 75” inch interactive flat panel, for education. product specification: color- black, power consumption- 500 w, size/dimension- 75 inch, usage/ application- education, effective touch area: 74.6 inch x 42 inch, aspect ratio- 16:9, weight- 75.5kg, resolutio...

Due Date : Nov 18, 2024
Tender Value : rupee 32.93 Lakhs
View Notice
64

Government Departments - kokrajhar - Assam

45947978 installation of digital class room- ii, iii & iv (three class rooms) and 20 nos. desktop computers lab. & etc. at girls’ college, kokrajhar in kokrajhar district , interactive flat panel 75”: black 75” inch interactive flat panel, for education. product specification: color- black, power consumption- 500 w, size/dimension- 75 inch, usage/ application- education, effective touch area: 74.6 inch x 42 inch, aspect ratio- 16:9, weight- 75.5kg, resolution- 3840(h)*2160(v) pixels, dimension mm- 2211*...

Due Date : Nov 18, 2024
Tender Value : rupee 68.69 Lakhs
View Notice
65

Government Departments - shimla - Himachal Pradesh

45947930 e-tender for the supply surgical items to igmc and hospital shimla , allis foceps specifications :-6 iso13485:2016,iso9001:2015 ce/usfda size: - , allis tissue forceps specifications :-6 iso13485:2016,iso9001:2015 ce/usfda size: - , auto fusion set i.v. specifications :-ce size: - , back rest iron specifications :- size: - , bmw bins foot operated red/yellow specifications :-iso,ce size: -10 litre , bmw bins foot operated red/yellow specifications :-iso,ce size: -20 litre , bmw bins foot operat...

Due Date : Nov 21, 2024
Tender Value : Ref. Document
View Notice
66

Government Departments - Kangra - Himachal Pradesh

45947575 auction sale of disposal of unserviceable store items 1 typewriter 01 no. 1992/unserviceable 2 office chair (with cusined arm) 03 no. 1992/unserviceable 3 fax machine 01 no. 2007/unserviceable 4 lecture stand (wooden) 01 no. 2002/unserviceable 5 moulded chair (with arm) 03 no. 2000/unserviceable 6 centre table 01 no. 2012/unserviceable 7 computer set 01 set 2010/unserviceable 8 printer 01 no. 2010/unserviceable 01 no. 2010/unserviceable 01 no. 2011/unserviceable 01 no. 2015/unserviceable 10 aeb...

Due Date : Nov 6, 2024
Tender Value : Ref. Document
View Notice
67

Boards / Undertakings / PSU - surat - Gujarat

45947439 supply, installation, commissioning and training of low velocity drop weight impact tester low velocity drop weight impact tester , supply, installation, commissioning and training of drop weight impact tester , supply, installation, commissioning and training of drop weight impact tester (detailed technical specifications of the items as per chapter – 8 enclosed with this notice) note:1. make/model of all items should be clearly mentioned in your bid. 2. latest & valid authorization certificat...

Due Date : Nov 21, 2024
Tender Value : Ref. Document
View Notice
68

Government Departments - Kamrup Metro - Assam

45947187 bids are invited for gift pen (q4) , metric scales (plastic) for general purposes as per is 1480 (q4) , paper weights (q4) , pen stand (v2) (q4) , black lead pencils (v2) as per is 1375 (q4) , stapler pin staples (v2) (q4) total quantity : 4286

Due Date : Nov 6, 2024
Tender Value : Ref. Document
View Notice
69

Government Departments - lucknow - Uttar Pradesh

45947101 tender for chief minister mass marriage gift material; 1 clothes 1. saree 2. blouse 3. petticoat 4-chunri 5. pheta saree 5.50 meter each with good quality embroidery free size stretchable (to match the saree) cotton freesize (to match the saree) red/maroon embroidered 2.25 meter for wedding 2.00 meter cloth pink or yellow 6. shirt, cloth, pant (pant length 1.20 m and shirt length 2.25 m, quality complete) 7. turban quality complete 2 vanity kit medium size - necessary materials for marriage inc...

Due Date : Dec 2, 2024
Tender Value : rupee 1 Crore
View Notice
70

Government Departments - bundi - Rajasthan

45946071 purchase of surgical items and sutures at bundi , suture item , braided e caprolactone coated lactomer 1, 90cm gs-25,37-40mm1/2 circle taper point , braided e-caprolactone coated lactomer 1-0 90cm gs-25 , undyed 37-40mm 1/2 circle reverse cutting , monofilament synthetic absorbable suture poliglecaprone 25 - undyed ep 3-0,70 cm,1/2 circle oval r.b. j.b. needle,26 mm , braided coated polyglactin absorbable suture polyglactin 910 -undyed 3-0, 3/8 circle reverse cutting,ps prime 24 mm,75 cm , poly...

Due Date : Nov 13, 2024
Tender Value : rupee 40 Lakhs
View Notice
71

Statutory Bodies & Commissions/Committees - balaghat - Madhya Pradesh

45945428 supply of material and instruments , supply of material & instrument , air conditioner 2 ton , air conditioner 1.5 ton , almirah for record keeping , attendant table , autoclave , b.m.i monitor , b.m.w dustbin complete set (pedal) , b.p instrument , baby warmer , bed side screen , bench for patients , bi-pap machine , body freezer , crush cart trolley , defibrillator , delivery table , digital watch , digital weight machine , dressing trolley , ecg machine , electric stature , equipment table ,...

Due Date : Nov 16, 2024
Tender Value : Ref. Document
View Notice
72

Government Departments - Kerala

45945326 supply of industrial safety helmetindustrial safety helmet,industrial safety helmet isi certified, colour- blue(10 no.s) and white (15 no.s), with exclusive ra tchet type adjustment, with adjustable chin strap as per is 2925 or latest. colour and quantity as per the anne xure attached. [ warranty period: 12 months after the date of delivery ] ] , industrial safety bump cap/safety helmet quality of shell= high quality,high impact ,light weight ,tough chin strap material= high quality nylon fiber...

Due Date : Oct 30, 2024
Tender Value : Ref. Document
View Notice
73

Boards / Undertakings / PSU - Kota - Rajasthan

45943808 misc petty works at kvk anta, dismantling old plaster or skirting, raking out joints and cleaning the surface for plaster including disposal of rubbish to the dumping ground within 50 meter lead. repairs to plaster of thickness 12mm to 20mm in patches of area 2.5 sq. metres and under including cutting the patch in proper shape, raking out joints and preparing and plastering the surface of the walls complete including disposal of rubbish to the dumping ground within 50 m lead with cement mortar ...

Due Date : Nov 8, 2024
Tender Value : rupee 2.74 Lakhs
View Notice
74

Statutory Bodies & Commissions/Committees - pune - Maharashtra

45943571 tender for seed bioreactor total volume: 7 liter; clean-in place (cip) and sterilize-in-place (sip) function automatic temperature control automatic filter sterilization automatic vessel cleaning and sterilization automatic foaming control automatic agitation control automatic aeration control automatic do control with cascading function automatic nutrient feeding automatic back pressure monitoring and control independent control panel for seed reactor with touchscreen hmi high speed plc tcp m...

Due Date : Nov 26, 2024
Tender Value : rupee 1 Crore
View Notice
75

Boards / Undertakings / PSU - Kota - Rajasthan

45943205 misc petty works at kvk bundi, painting exterior surface of wall with 100% acrylic exterior paint of approved brand and manufacture to give an even shade with two or more coats including prepartion of base with sand papering, primer, putty, etc complete in all respect including scaffolding and safety provision old work painting with synthetic enamel paint of approved brand and manufacture to give an even shade: one or more coats on old work. wall painting with plastic emulsion paint of approved...

Due Date : Nov 8, 2024
Tender Value : rupee 2 Lakhs
View Notice
76

Government Departments - prayagraj - Uttar Pradesh

45941176 tender for bandage and dressing consumables, bandage & dressing consumables , adhesive tape 7.5cm x 5m (water repellent and breathable, high adhesive strength, easily removable, contains latex size: 7.5 cm x 5 m) , band aid piece(material: flexible fabric nonstick sterile adhesive bandage, memory weave fabric flexibility le ngth (inch):3 inch width(inch):1 inch weight: 0.5 gm) , bandage than 100cm x 20m (material: cotton, colour: white size: 100cm * 20mtr) , cotton roll 500gm (features: highly ...

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
77

Statutory Bodies & Commissions/Committees - Udhampur - Jammu And Kashmir

45940777 bids are invited for tactical plate carrier with modular light weight load carrying equipment (molle) pouches total quantity : 2300

Due Date : Nov 16, 2024
Tender Value : Ref. Document
View Notice
78

Government Departments - WALTAIR - Andhra Pradesh

45940188 auction sale of condemned and u/s. e-waste of electronic items pertains to sse/signal/vskp under sr. dste/wat, as per attached lot details. the description, quantity and weight as per image. total deliverable quantity is 12 nos, equivalent to 32 kgs. material is lying at sse/tele/stores/vskp under sr. dste/wat. hsn code- 85481090, gst-18%. [sr.dste/wats offer statement letter no. wss/wat/scrap/2023, dt- 13.02.2024]. sale and delivery by lot. registered recyclers of moef/cpcb only to bid and als...

Due Date : Nov 2, 2024
Tender Value : Ref. Document
View Notice
79

Government Departments - Jagadhri - Haryana

45940088 supply of ball valve for sanitary facilities forball valve for sanitary facilities for,ball valve for sanitary facilities for lhb coaches drawing no.: - lw 63106 alt.(a), item-3. drawing no. lw 63106 alt.(a) for item-3 is for tender purpose only. supplier has to submit detailed dra wing at the time of participation in tender with confirmation of weight of item. [ warranty period: 30 months after the date of delivery ] [quantity tolerance (+/-): 5 %age , item category : normal , total po value v...

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
80

Government Departments - Ponmalai - Tamil Nadu

45937850 supply of 68246421 - tin ingot.68246421 - tin ingot.,tin ingot grade sn 99.85 percent weight of each ingot approx 29 to 30 kgs. to is 26/1992. [ warranty period: 30 months after the date of delivery ] ]

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
81

Government Departments - jodhpur - Rajasthan

45937604 supply of hydraulic standard series bottle jack, screwed ram with safety lock nut and integral pump, capacity in tons: 50,hydraulic standard series bottle jack, screwed ram with safety lock nut and integral pump, capacity in tons: 50,,hydraulic standard series bottle jack, screwed ram with safety lock nut and in tegral pump, capacity in tons: 50, closed height: 325 mm, hyd lift: 150 mm, extended height: 4 75 mm, ram dia: 100 mm, body dia: 198 mm, base size: 240x300 sqmm, weight 70 kgs (approx)....

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
82

Government Departments - Bilaspur - Chhattisgarh

45937583 tender for maintenance of 40 metre light weight narrow base tower by providing missing members, nut bolt tightening, painting etc. at bagdeva, district : korba under bilaspur ba

Due Date : Nov 6, 2024
Tender Value : rupee 1.30 Lakhs
View Notice
83

Government Departments - Bilaspur - Chhattisgarh

45937576 name of work:- erection of 40 metre light weight narrow base tower after dismantling/dismembering including providing & fixing missing members, painting etc. at balgi mines in district : korba under bilaspur business area.

Due Date : Nov 8, 2024
Tender Value : rupee 3.35 Lakhs
View Notice
84

Government Departments - Ahmedabad - Gujarat

45937379 bids are invited for desk pads - writing (v2) (q4) , rollerball pen (v3) (q4) , knife blades (q4) , black lead pencils (v2) as per is 1375 (q4) , manual pencil sharpener (v2) (q3) , transparent tape (v2) (q4) , stamp pads (q4) , carbon papers as per is 1551 (q4) , rubber bands (q4) , paper or eyelet punches (q4) , paper weights (q4) , desktop calculator - electronics (q4) , stamp - pad ink as per is 393 (q4) , ball point pens (v2) as per is 3705 (q4) total quantity : 3743

Due Date : Nov 11, 2024
Tender Value : Ref. Document
View Notice
85

Boards / Undertakings / PSU - Bokaro - Jharkhand

45937348 bids are invited for 1. touch screen kiosk with biometric, cctv, microphone, etc 2. desktop computer 3. scanner-copier-printer (3 in 1) 4. video conferencing system 5. dslr camera 6. 7. ups with solar system facility 8. servo stabilizer vertical sinage display 9. epos machine b furniture 1. office table with cabinet 2. office chair 3. cushioned chairs 4. outdoor chairs (pvc/fibre) 5. steel lockers (5 shelves) 6. display racks 7. white board 8. branding c repairs and renovations 1 supplying of o...

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
86

Statutory Bodies & Commissions/Committees - Tirupati - Andhra Pradesh

45937332 bids are invited for 1 platform trolley reliable leak-proof & adjustable pump eliminating maintenance and extending the service time. choose between multiple options of width over fork and fork length suitable for your application. with a heavy-duty build quality and an extensive reach of our service network, bf115052085puyel 2 each 2 mobile garbage can • with rust, dent, chip or peel free. • heavy duty pedal mechanism. • tight fitting overlapping lid. • with round corner. • container equipped...

Due Date : Nov 16, 2024
Tender Value : Ref. Document
View Notice
87

Local Bodies - Samastipur - Bihar

45937211 tender for the supply of blankets - the minimum length and width of the woolen blanket should be 7.5 feet x 5 feet and the minimum weight should be 2.4 kg.

Due Date : Nov 11, 2024
Tender Value : Ref. Document
View Notice
88

Government Departments - orai - Uttar Pradesh

45936747 tender for in year 2024-25 special repair and cc work of jalaun bhind to mijhauna link road in km. 1; 1 providing laying spreading and compacting stone aggregates of specific size 22.4-53 mm to water bound macadam specificationincluding spreading in uniform thickness, hand packing rolling with smooth wheel roller 80-100 km in stages to proper grade and camber , mord g-3 2 providing and applying tack coat with bitumen vg-10 using bitumen distributor @ 0.30 kg / sqm on the prepared dry and hun...

Due Date : Nov 6, 2024
Tender Value : rupee 16.32 Lakhs
View Notice
89

Government Departments - Goa - Goa

45936722 supply of lsa ffa safety equipments for marine workshop betim , eva foam fenders (no bl 303) of circumference -31” dxlxo – 10”x 26” x 2.7 cm for buoyancy 28 kg and boat upto 50 to 70 ft. (sample should be submitted for approval) , fire extinguisher abc type map50 2 kg gun housing make:- ceasefire , f.r.p life buoys (ring buoys) for single person complete with r.r. tape, polypropylene becket line and approved by mmd or qualified classification societies such as irs as per directorate general of ...

Due Date : Nov 25, 2024
Tender Value : rupee 17 Lakhs
View Notice
90

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

45936492 bids are invited for servicing of treadmil , servicing of gym weights machines, , servicing of cardio gym equipment , replacement of treadmill belt and rotor , floor paint and marking of basketball court , repair of basketball court surface , yearly top paint marking of volleyball court , repair and maintenance of lights , repair to surface replacement of boards, poles, lights, nets and yearly paint - maintenance and repair of gym equipment, maintenance and repair of basketball court, maintenan...

Due Date : Nov 16, 2024
Tender Value : Ref. Document
View Notice
91

Government Departments - Hazira - Gujarat

45936248 tender for 33426701 - vibrofeeder spares - mh 33426701 0001 0001 300118248 housing,f/exciter,vibrofeeder,ic technical details name : navneet kumar shukla contact : 9909901012 email : navneet.shukla@amns.in 2 no housing major equipment : exciter , major equipment model : vibrofeeder major equipment make : ic , additional information : (260.1v) type : bearing item details : 1. in case of any query, vendor must discuss with amns or visit the site before offer submission or manufactuing process 2. ...

Due Date : Nov 7, 2024
Tender Value : Ref. Document
View Notice
92

Statutory Bodies & Commissions/Committees - Jalandhar - Punjab

45936122 bids are invited for as per boq paper weight , stamp col veterans , stamp dy goc , table glass , flex board printing and pasting , transparent triangle name plate , exide battery 180 amp , photocopy machine repair , date stamp , appoint board , curtains for door , curtains rod , appointment plate , executive chair , visitor chair for office , pen stand , wall clock , in out light , table lamp , multi plug 15 amp , carat plastic for vegetables paper weight, stamp col veterans, stamp dy goc, tabl...

Due Date : Nov 16, 2024
Tender Value : Ref. Document
View Notice
93

Government Departments - Dibrugarh - Assam

45935402 tender for procurement of cathodic protection for duliajan to ip-1a (existing sv-02) pipeline project to replace existing pipeline section 16” dia x 55 km of duliajan numaligarh pipeline.- design. supply, installation, testing and commissioningof temporary cathodic protection system for duliajan to ip-1a (existing sv-02) pipeline project to replace existing pipeline section 16” dia x 55 km of duliajan numaligarh pipeline. 2 survey, design, detail engineering, manufacturing, inspection/fat (fac...

Due Date : Nov 14, 2024
Tender Value : Ref. Document
View Notice
94

Government Departments - katni - Madhya Pradesh

45935109 supply of supply of tools set consisting of 1/2incsupply of tools set consisting of 1/2inc,supply of tools set consisting of 1/2inch square drive socket set containing 19 sockets with 6 attachments (2 nos exten sion bar, 1 no universal joint, 1 no t- handle, ratchet handle, speeder brace) with additional angle handle as per s- 16hxl of taparia make duly packed in metal powder coated carry case. all the dimensions and weight are same or more than items in taparia product number s-16hxl. material...

Due Date : Nov 6, 2024
Tender Value : Ref. Document
View Notice
95

Statutory Bodies & Commissions/Committees - pune - Maharashtra

45934076 bids are invited for light weight non leather antiskid rubber sole and oil resistant single density sole low ankle and isi grade certified shoes size 9 , light weight non leather antiskid rubber sole and oil resistant single density sole low ankle and isi grade certified shoes size 10 , light weight non leather antiskid rubber sole and oil resistant single density sole low ankle and isi grade certified shoes size 6 , light weight non leather antiskid rubber sole and oil resistant single density...

Due Date : Nov 16, 2024
Tender Value : Ref. Document
View Notice
96

Government Departments - Tiruchirappalli - Tamil Nadu

45934004 bids are invited for staple pin remover , ink for stamp pad , pencil hb drawing , pen for officers , pen stand , paper weight rubber , paper duplicating a4 size , duplicating paper a4 blue , ball point pen with blue refill , stamp pad , staple machine small max 10 , back sheet , carbon for pencil writing , chalk white , chalk colour , gem clip 35mm , paper clip plastic , twine ball , examination clip pad , eraser pelikkan , rubber band 100percentage nylon , hilighter marker , white board marker...

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
97

Statutory Bodies & Commissions/Committees - Firozpur - Punjab

45933931 bids are invited for bench with adjustable mode for weight trg of troops , grip mat for weight trg of troops , oly rod for weight trg of troops , weight trg eqpt bouncer for troops , weight trg eqpt viva plates for troops total quantity : 360

Due Date : Nov 16, 2024
Tender Value : rupee 94500.0
View Notice
98

Government Departments - KORAPUT - Odisha

45933925 bids are invited for 1 1000068939_1_67402103560 chain pulley cap: 5t lift : 10 mtr extra heavy duty light weight triple spur gear hand operated chain pulley block having isi mark conforming to is 3832-2005 m1(safety factor 4:1)classification (swl=100% of wll) capacity: 05 ton; lift: 10 mtr., no. of fall : 2 load test certificate and oem/oem authorisation certificate to be supplied. 2 ea arbind.singh 120 2 1000068939_2_81815013160 d-shackle, capacity-7.5t wide mouth forged shackles 7.5 ton capac...

Due Date : Nov 15, 2024
Tender Value : Ref. Document
View Notice
99

Government Departments - Shahid Bhagat Singh Nagar - Punjab

45933844 supply of black polythene sheet , black polythene sheet , black polythene sheets of following specification:- a)material should be as per is-2508-1984 reaffirmed 2003. b)thickness of sheet should be minimum 250 micron approx. size of sheet 85 ft. length x 18 ft. width. c)tensile strength --- longitudinal direction – 140 kgf/cm² transverse direction – 110 kgf/cm². coverage area -1 kg. weight of black polythene sheet will cover 40-50 sq.ft approx. note:-sample of the black polythene sheet will be...

Due Date : Nov 4, 2024
Tender Value : Ref. Document
View Notice
100

Statutory Bodies & Commissions/Committees - KORAPUT - Odisha

45933778 bids are invited for 42-500-hand-drill-machine hand drill machine with tool kits 650 watt power 650 w voltage 220 v 4 point 5 arpm 0 to 3150 rpmmax impact rate 0 to 47000 bpm drill size 2mm to 10 mm 42-501-abrasive-cutting-machine abrasive cutting machine with tool kits 650 watt power consumption watt 650wcutting disc size inch 4 inch or 6 inchno load speed rpm 6000 rpmfrequency 50 hzvoltage 220 v 4 point 5 a 42-502-hydrau...

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail