Paints And Primers Tenders from India

447 Paints And Primers tenders are published by various Tendering Authorities & Private companies. 447 live Tender for Paints And Primers are available in Paints And Primers Tender section You can further filter Paints And Primers tenders by Tender Value, Tender Submission Date or Project Location.

1

Cooperative - Muzaffarnagar - Uttar Pradesh

43433663 supply of various industrial paint , berger/asian paint , hr aluminium/paste paint for boiler 250c , post office red paint , bus green paint , golden yellow paint , azure blue paint , smoke gray paint , red oxide metal primer , heat resistance zink chromate red oxide paint , off white paint , white paint , aluminium paint , heat resistance hr black paint , thiner

Due Date : May 28, 2024
Tender Value : rupee 2 Lakhs
View Notice
2

Government Departments - SRIHARIKOTA - Andhra Pradesh

43433643 bids are invited for polyurethane full gloss enamel (two pack) as per is 13213 (q3) , epoxy based zinc phosphate primer (two pack) epoxy based zinc phosphate primer (two pack) as per is 13238 (q3) mse total quantity : 850

Due Date : May 31, 2024
Tender Value : Ref. Document
View Notice
3

Government Departments - Srinagar - Jammu And Kashmir

43433452 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932,enamel, synth total quantity : 75

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
4

Statutory Bodies & Commissions/Committees - Meerut - Uttar Pradesh

43433447 bids are invited for procurement of fasteners paint and welding items - split pin , washer spring single coil , bolt mteric hex hd , nut metric hex hd , washer spring single coil , aluminium blind rivet , steel screw self taping flat hd no 8 19mm long , steel screw self taping flat hd no 8 25mm long , steel screw self taping flat hd no 8 13mm long , hinge , bolt metric hex hd , sliding bolt stainless steel , steel tower bolt stainless steel , door lock heavy duty right , allen screw csk hd 8mm ...

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
5

Statutory Bodies & Commissions/Committees - Jalpaiguri - West Bengal

43432640 bids are invited for split ac split ac , powder coated sheet metal , concealed type wiring , mcb distribution board , mcb single pole and neutral , angle iron bracket , earthing complete , pvc insulated , sub main wiring total quantity : 418

Due Date : Jun 11, 2024
Tender Value : Ref. Document
View Notice
6

Boards / Undertakings / PSU - Bokaro - Jharkhand

43431803 bids are invited for di-electric paint,di-electric primer total quantity : 370

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
7

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

43431801 bids are invited for tape nylon 26 mm thin grey bs 200 kg total quantity : 3932

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
8

Government Departments - Madurai - Tamil Nadu

43431749 supply of enamel, synthetic, exterior, finishing ` white to spec. is:8662/04 (ra-2019) or the latest and icf /md/spec- 045, issue status 2, rev.03 with amdt. dt. 22/4/2008 or the latest. the pigment content shall be 6% minimum (by mass) as per rdso lr.no. m&c/pcn/i/64/i/vol.ii dated 12/5/2016 as rdso amdt. no.1 packing condition- packed in 20 litres new, sound and non-returnable ms drums to is 2552/89 (ra -2018) with amdt.n o.1 gr.b2 [ warranty period: 30 months after the date of delivery ] =>...

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
9

Government Departments - Ponmalai - Tamil Nadu

43431598 supply of enamel, synthetic, exterior, finishing air craft blueenamel, synthetic, exterior, finishing air craft blue,enamel, synthetic, exterior, finishing air craft blue to isc-108 of is.5/2007. specification: is.8662/04 and i cf/md/spec-045, issue status-2, rev.03 with amendment dtd.22-04-08. the pigment content shall be 6% minimum (by mas s) as per rdso letter no m&c/pcn/1/64/1/vol.ii dt 12.05.2016 as rdso amendment no 1. packing condition: packed in 20 litre s new, sound and non-returnable ...

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
10

Government Departments - LEH - Jammu And Kashmir

43431557 bids are invited for cement , course sand , stone aggregate 10 mm , stone aggregate 20 40mm , reinforcement steel bar , ms pipe tube plate , welding rod , galvanized iron corrugated sheet , angle iron 40x40x6 mm , ply board 32 mm , gi plain jali , wooden batten 2 , precast cement concrete block , synthicic enamel paint , painting brush 4 inch , painting brush 2 , aluminium handle 5 , aluminium tower bolt 8 , aluminium slinding bolt 12 , iron hings 4 , steel screw , door closer , door stopper , ...

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
11

Government Departments - bhavnagar - Gujarat

43431444 supply of under coat paint to math colour ral ds 0 [under coat paint to math colour ral ds 0708040 spec is : 8662/2004 (second rev) or latest with additional requirement of icf specification no icf/md/spec.045 issue status -02 rev-03 with amendment dt. 22.04.2008 the pigment content shall be 6% minimum (by mass).as per rdso latter no m&c/pcn/1/64/1 vol ii dt.12.05.2016 amendment no 1 packing in 20 ltrs. ]under coat paint to math colour ral ds 0 [under coat paint to math colour ral ds 0708040 sp...

Due Date : Jun 4, 2024
Tender Value : Ref. Document
View Notice
12

Statutory Bodies & Commissions/Committees - Baramulla - Jammu And Kashmir

43431397 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 144

Due Date : May 31, 2024
Tender Value : Ref. Document
View Notice
13

Statutory Bodies & Commissions/Committees - Baramulla - Jammu And Kashmir

43431374 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 160

Due Date : May 31, 2024
Tender Value : Ref. Document
View Notice
14

Government Departments - Bathinda - Punjab

43430974 supply and delivery of paints

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
15

Statutory Bodies & Commissions/Committees - NEW DELHI - Delhi

43430934 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 15

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
16

Cooperative - tiruttani - Tamil Nadu

43430534 supply of paints , supply of paints , anticorrosion heat resistance black , make : berger, ferrotol no. 1 , make : berger, apexior no. 3 , thinner , painting brush make: amar , size : 2 , painting brush make: amar , size : 3 , painting brush make: amar , size : 4 , painting brush make: amar , size : 6 , heat resistance white paint - arasu paints (or) tansi , enamel gray , enamel bus green , enamel white , enamel golden yellow , enamel sky blue , enamel post office red , acblack , red oxide , zi...

Due Date : Jun 3, 2024
Tender Value : Ref. Document
View Notice
17

Government Departments - bhopal - Madhya Pradesh

43430241 supply of paint blackpaint black,paint enamel synthetic brushing finishing exterior black (packing in 20 ltrs new non returnable m.s . drum) this is shelf life items and should be procured with staggered delivery period . supplier to mention/print d ate of manufacturing on the item & item to be supplied within 60 days of manufacture date. specn: is: 8662/2004 with additional requirement stipulated in icf specification no. icf/m/d/spec 045 issue status 02 revision 03 exc ept clause c3 of is: 866...

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
18

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43430087 bids are invited for led rechargeable , bulb 24v , white paint , green net , anchor wireless bell total quantity : 250

Due Date : Jun 11, 2024
Tender Value : Ref. Document
View Notice
19

Statutory Bodies & Commissions/Committees - Leh - Jammu And Kashmir

43429808 bids are invited for boq ord rfu paint blue , rfu paint white , rfu red paint , rfu paint yellow , paint alluminim , welding rod , lt wire , jointing sheet , leather cream cloth , dentride sr 998 , foam sheet total quantity : 122

Due Date : Jun 11, 2024
Tender Value : Ref. Document
View Notice
20

Statutory Bodies & Commissions/Committees - Agra - Uttar Pradesh

43429393 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 1056

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
21

Statutory Bodies & Commissions/Committees - Tinsukia - Assam

43429369 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 40

Due Date : May 31, 2024
Tender Value : Ref. Document
View Notice
22

Government Departments - LEH - Jammu And Kashmir

43428824 bids are invited for cement , course sand , plain glass 5 mm thick , precast cement concrete block , synthicic enamel paint , acrylic smooth exterior paint , painting brush 4 , painting brush 2 , aluminium handle 5 , aluminium tower bolt 8 , aluminium slinding bolt 12 , iron hings 4 , steel screw , silicon adhesive gun , m seal 100 gm , door closer , door stopper , tarpet roll 20 mtr per roll , ply board 32 mm , ply board 10 mm , wp wire 10 sqmm , mcb box 4 way , mcb dp 20 amp , mcb 6 amp , in...

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
23

Government Departments - Karaikal - Puducherry

43428625 tender for procurement of heat resistant paint epoxy paint and epoxy thinner for painting of chimney

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
24

Government Departments - karwar - Karnataka

43428523 procurement of antistatic polyamide epoxy paint (m204 v2) for ins khanderi at nsry (kar) , material , antistatic polyamide epoxy paints (m204-kit a+b) packaging 1 can =5 liters moq= 20 liters make castellano

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
25

Government Departments - rourkela - Odisha

43426971 supply of airless spray painting machineairless spray painting machine,airless spray painting machine as per annexure-a attached. make/model- graco inc.usa o r jaguar or statfield or similar [ warranty period: 30 months after the date of delivery ]

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
26

Government Departments - Chennai - Tamil Nadu

43426813 supply of brush paint flat bentbrush paint flat bent,brush paint flat bent for painting bogies size 41mm flat 335 mm body lengt h todrawing no. icf/j&t/misc 1032 alt g. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
27

Government Departments - Chennai - Tamil Nadu

43426658 supply of full gloss polyurethane enamel finishing paintfull gloss polyurethane enamel finishing paint,supply of full gloss polyurethane enamel (two pack)finishing paint to sp ecn.rdso/mc/pcn/100/2018 ral shade no: 7004 (signal grey) [ warranty period: 30 months after th e date of delivery ] furnishing tamil nadu 153.00 litre => limited

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
28

Government Departments - bhopal - Madhya Pradesh

43426545 supply of paint enamel synthetic exterior finishin [paint enamel synthetic exterior finishing white is: 8662/2004 .........paint enamel synthetic exterior finishin [paint enamel synthetic exterior finishing white is: 8662/2004 .........,paint enamel synthetic exterior finishing white is: 8662/2004 with additional requirement stipulated in icf specification no. icf/m/d/spec 045 issue status 02 revision 03 except clause c3 of is:8662/2004 & colou r category-i. packing in 20 ltrs new non-returnabl...

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
29

Government Departments - Chennai - Tamil Nadu

43426484 supply of full gloss polyurethane enamel (two pack)full gloss polyurethane enamel (two pack),full gloss polyurethane enamel (two pack) exterior finishing paint to sp ecn rdso m&c/pcn/100/2018 chapter-v to shade no ral ds-240-60-35 (compatible with oth er system paints) [ warranty period: 30 months after the date of delivery ] furnishing tamil nadu 1485.00 litre => limited

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
30

Statutory Bodies & Commissions/Committees - Firozpur - Punjab

43426267 bids are invited for cement bleaching powder , cement 50 kgs , wire nails , welding rod , brush cutter wire , white spirit acid , plaster of poris , distemper white , olive green paint , white paint , black paint , red paint , dark blue paint , brown paint , thinner , terracotta colour , brush 2 inch , teak wood colour , rose wood colour , nylon rope 200 mtr total quantity : 438

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - Ratnagiri - Maharashtra

43426143 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 250

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
32

Government Departments - Ratnagiri - Maharashtra

43426139 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 100

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
33

Boards / Undertakings / PSU - hyderabad - Telangana

43425599 nshes-supply of paints at nshes, nagarjunasagar.

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
34

Boards / Undertakings / PSU - Multi State

43425476 tender for srbhes-procurement of various paints .

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
35

Government Departments - Ernakulam - Kerala

43424582 bids are invited for procurement of paints- paint brush 4 inch , paint brush 2 inch , paint brush 1 inch , paint rfu golden yellow , paint rfu signal red , paint rfu azure blue , paint rfu black , paint rfu green , paint exterior rfu finishing white , paint rfu navy blue , paint rfu spraying white total quantity : 1097

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
36

Statutory Bodies & Commissions/Committees - Hyderabad - Telangana

43424561 bids are invited for thinner aspa,paint yellow total quantity : 60

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
37

Statutory Bodies & Commissions/Committees - Porbandar - Gujarat

43424529 bids are invited for procurement of packing materials -thermocle 12mm size 3x2 nail 1.5 nail 1 hard wood 4x0.5 hard wood 6x0.5 marine plywood 12mm size 6x4 marine plywood 8mm size 6x4 green nursery cloth (16x64) terracota paint white sewing thread 100 cotton colour white 800 mtrs roll potyester plastic strapping belt 12 mm thickness 0.50 mm galvanised iron strapping belt 12 mm thickness 0.50 galvanised iron strapping belt 12 mm thickness 0.50 thermocle 50 mm size 3x2 thermocle 25 mm size 3x2 st...

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
38

Statutory Bodies & Commissions/Committees - delhi - Delhi

43423945 bids are invited for stationery , add gel achiver blue , add gel achiver red , ball pen refill blue , ball pen refill red , ball pen reynolds blue , binder clip 32mm , calculator , calling bell , cd cover , cd marker black , cd recordable , cd rewritable , colin surface cleaner 500ml , colour drawing sheet red green yellow blue and white each , colour tape 1 by 2 inch orange , colour tape 1 by 2 inch red , colour tape 1 by 2 inch blue , colour tape 1 by 2 inch green , colour tape 1 by 2 inch ye...

Due Date : Jun 10, 2024
Tender Value : rupee 2 Lakhs
View Notice
39

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

43423886 bids are invited for chromate epoxy primer total quantity : 25

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
40

Cooperative - baghpat - Uttar Pradesh

43423405 supply of industrial and decorative burger make paints for year, 2024-25 , synthetic enamelled smoke gray , bus green , black , azure blue , golden yellow , yellow , p.o. red , redoxidezincchromateprimer , thinner-800 , black bituminious is-158 , zed green , white , alluminium paint , ferretol no.1 , ferretol hr alluminium , apexier no.3 , h.r. heat resistant alluminium paste with medium for boiler chimney , general purpose thinner , synthetic enamel off-white

Due Date : Jun 3, 2024
Tender Value : Ref. Document
View Notice
41

Government Departments - chennai - Tamil Nadu

43423300 supply of paint remover solventpaint remover solvent,paint remover solvent type non inflammable to is : 430/1972 (second revision) (amendment 1) or latest. s pec: is:430/1972(ra-2019) . [ warranty period: 24 months after the date of delivery ] => limited

Due Date : Jun 5, 2024
Tender Value : Ref. Document
View Notice
42

Government Departments - Halisahar - West Bengal

43423206 supply of procurement of paint enamel synthetic interior finishing white.procurement of paint enamel synthetic interior finishing white.,paint enamel synthetic interior finishing white to is: 133/2023 (rev-06) (alongwith requirements mentioned in table-2) alongwith additional requirement as laid down in icf str no. icf/md/spec-052 issue sta tus:02 rev 01 dt. 26.05.2006 under rdso amendment no. 1a (rev 1.0 effective from june 2020) as an addition al requirement. shelf life 12 months. [ warranty ...

Due Date : Jun 20, 2024
Tender Value : Ref. Document
View Notice
43

Government Departments - jodhpur - Rajasthan

43423107 supply of two component polyurethane based matt anti graffiti paint.two component polyurethane based matt anti graffiti paint.,two component polyurethane based matt anti graffiti paint (top coat) to mdts-118 - rev.01, tabl e 5 with matt finish gloss value 10-12 at 60 degree of colour shade ral-9006 as per rcf letter md 22151 dtd.0 5.09.2023 [ warranty period: 30 months after the date of delivery ] shop supdt.(paint) ju, rajasthan 200.00 litre

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
44

Government Departments - erode - Tamil Nadu

43423080 supply of paint remover (in aerosol container), in 420ml, to remove pu ,epoxy and acrylic paint coatings darien pgr/55 of anabond make or rustlic/ chemique /fosroc/bostik/loctite/molykot or equivalent. viscosity at 30 degree celsius, brookfield dv-ll plus,adtm-r006 (lso 2555), cps - 8 -15. specific gravity at 30 degree celsius to be 1.15 to 1.25. please note: uploading of products specification / catalogue by bidders is mandatory2) one sample will be provided for approval before effecting bulk ...

Due Date : Jun 12, 2024
Tender Value : Ref. Document
View Notice
45

Government Departments - Tirupati - Andhra Pradesh

43423020 supply of paint synthetic enamel interior whitepaint synthetic enamel interior white,paint synthetic enamel interior white under coating matt finish to is: 133 (part 1) - 2013 with ame ndment no 1 july 2015 brushing quality with additional requirement of icf/md/spec-052 issue status: 02, rev. no.01 dtd.26.05.2006 & rdso amendment no.1a as an additional requirement. [ warranty period: 30 months after the date of delivery ] carr. repair stores/tpty, andhra pradesh 3360.00 litre => limited

Due Date : May 30, 2024
Tender Value : Ref. Document
View Notice
46

Government Departments - Bongaigaon - Assam

43422833 bids are invited for supply of item -paint readymix brushingfinishing olivegreen. matspec. bis,is-i 3607/1992& isc-220. total quantity : 22000

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
47

Local Bodies - Udaipur - Rajasthan

43422740 bids are invited for 5x25mm , gypsum screw 5x30mm , gypsum screw , l shape angle patti , cylinder pc11kn 6omm kich tt , table rubber bush as per sample , chair rubber bush as per sample , ss telescopic channel , tower bolt 4 inch , tower bolt 12 inch , multipurpose lock 15mm drawer, cupnoard , cupboard lock long knob key 6lever 75mm , door closer , door seal 3ft , pvc gitti 35x8mm , screw 35x8mm , gypsum cemented sheet , ply 6mm greenply , ply 18mm greenply , ply 12mm greenply , acrylic sheet 3...

Due Date : Jun 10, 2024
Tender Value : rupee 5 Lakhs
View Notice
48

Statutory Bodies & Commissions/Committees - Darjeeling - West Bengal

43422617 bids are invited for ttieg black paint , red paint , yellow paint , white paint , silver paint , green paint , blue paint , maroon paint cherry f , brush 1inch , brush 2inch , brush 4inch , thinner , terracotta maroon , terracotta white total quantity : 208

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
49

Boards / Undertakings / PSU - Imphal West - Manipur

43422433 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) , ready mixed paint, air drying, red oxide zinc chrome, priming as per is 2074 (q3) , thinner for epoxy paints (bhel) (q3) total quantity : 8098

Due Date : Jun 6, 2024
Tender Value : rupee 44.80 Lakhs
View Notice
50

Statutory Bodies & Commissions/Committees - West Kameng - Arunachal Pradesh

43422190 bids are invited for sheet cellular foam sheet , soldier soft wire , soldier flux , rod welding silicon bronze 3.15 mm , m seal 90 gms , fevi quick 15 gms , ana bond , araldite 100 gms , wire 1 mm , paint finisher , tarpion oil , thinner anti chill , paint hardner total quantity : 158

Due Date : Jun 8, 2024
Tender Value : Ref. Document
View Notice
51

Government Departments - Jhansi - Uttar Pradesh

43422023 bids are invited for epoxy primer tre 166 , matching thinner for epoxy paint primer spec. tre168166, rev 01. total quantity : 4200

Due Date : May 29, 2024
Tender Value : Ref. Document
View Notice
52

Boards / Undertakings / PSU - Koradi - Maharashtra

43421998 tender for supply and commissioning of anti corrosive hcl tank (3 mt capacity) & 300 kg capacity at water treatment plant (210 mw) ktps, koradi.

Due Date : Jun 4, 2024
Tender Value : rupee 18.96 Lakhs
View Notice
53

Government Departments - Halisahar - West Bengal

43421572 supply of procurement of pu paints kit consisting of 7 componentsprocurement of pu paints kit consisting of 7 components,pu paints kit consisting of 7 components : (1) two component pu top coat apricot y ellow to ral-0708040 rdsos spec no. m&c/pcn/100/2018, with rdsos amendment no. 1b, (rev 2.0 effec tive from september 2020) as an additional requirement. qty per kit - 48 ltrs. (2)two component pu top coat bl ood red to ral-0303045 spec. no- m&c/pcn/100/2018, with rdsos amendment no. 1b, (rev 2...

Due Date : Jun 12, 2024
Tender Value : Ref. Document
View Notice
54

Statutory Bodies & Commissions/Committees - NASHIK - Maharashtra

43421438 bids are invited for indrox 2526m paint remover total quantity : 10680

Due Date : Jun 8, 2024
Tender Value : Ref. Document
View Notice
55

Government Departments - Parel - Maharashtra

43420260 supply of paint remover (in aerosol container),paint remover (in aerosol container),,paint remover (in aerosol container), in 420ml, to remove pu ,epoxy and acrylic paint coatings , make : darien pgr/55 of anabond make or rustlic/ chemique /fosroc/bostik/loctite/molykot or equivalent. sp ecification: viscosity at 30 degree celsius, brookfield dv-ll plus, adtm-r006 (lso 2555), cps - 8 -15. specific g ravity at 30 degree celsius to be 1.15 to 1.25. please note: 1) uploading of products specificat...

Due Date : Jun 13, 2024
Tender Value : Ref. Document
View Notice
56

Cooperative - sethiyathope - Tamil Nadu

43419642 purchase of paints , purchase of paints note : compulsay attached test, quarantee / performance certificate , metal premier red oxide , achr white , achr black , thinner , purchase of enamel paint note : compulsay attached test, quarantee / performance certificate , azure blue , golden yellow , smoke grey , enamel white , postal red , jade green

Due Date : Jun 1, 2024
Tender Value : rupee 62350.0
View Notice
57

Cooperative - sethiyathope - Tamil Nadu

43419639 purchase of luminos ups teflon tape insulation tape crc and shellac , purchase of luminos ups insulation tap teflon tap crc and shellac note : compulsay attached test, quarantee / performance certificate , ups make: luminous model : pro-1000 output: 230 v hz : 50 va : 1000 , insulation tap black and red color each colur 10 nos , teflon tap , crc , shellac

Due Date : Jun 3, 2024
Tender Value : rupee 25600.0
View Notice
58

Government Departments - bhopal - Madhya Pradesh

43417106 supply of paint aluminiumpaint aluminium,paint aluminium brushing, bright finishing to is:2339/1963. packing in 4 ltrs. dual containers. (this i tem is reserved for rdso approved sources ) this is shelf life items and should be procured with staggered deli very period . supplier to mention/print date of manufacturing on the item & item to be supplied within 60 days of m anufacture date. [ warranty period: 30 months after the date of delivery ] general stores depot bpl, madhya pradesh 2900.00 li...

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
59

Government Departments - Gorakhpur - Uttar Pradesh

43417064 supply of pu paint kit for lhb shatabdi coaches.pu paint kit for lhb shatabdi coaches.,pu paint kit for lhb shatabdi coaches. as per rdso spec. m&c/pcn/100/2018 with rdsos am ndt. no. 1b (rev.1.0) as an additional requirement (01) pu top coat colour gray (two pack) to ral no. ds-240- 60-05, (in 04 ltr. packing) total quantity per kit=20 ltr. (2) pu top coat colour blue to ral no. ds-260-60-35 (tw o pack) (in 04 ltr. packing) total quantity per kit=16 ltr. (03) pu surfacer, white to ral no. 7001...

Due Date : May 29, 2024
Tender Value : Ref. Document
View Notice
60

Government Departments - bhopal - Madhya Pradesh

43417033 supply of brushes 50 mm.brushes 50 mm.,brushes paint and varnish flat size 50 mm rubber set conforming to is-384 part-1-2012 (sixth revi sion) or latest and bristles to is- 1844/1993 or latest.(1)firm should submit four sample before opening of e-tend er as per rdso instruction otherwise offer will be ignored.(2) item is reserved to be purchased from nsic regd fi rms only. [ warranty period: 30 months after the date of delivery ]

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
61

Statutory Bodies & Commissions/Committees - Ernakulam - Kerala

43416971 bids are invited for purchase of paints total quantity : 480

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
62

Government Departments - Pathankot - Punjab

43416842 bids are invited for high pillar cock high pillar cock , curtain rod , glass putty , wall putty , brush , tarpolin oil , thinner , white paint , pvc pipe , switch , socket , condensor , clamp meter total quantity : 744

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
63

Statutory Bodies & Commissions/Committees - Jamnagar - Gujarat

43416798 bids are invited for ars items and paint aqua bond , quick dry steel putty , wet surface putty , safety gloves cloth , abrasive paper 230mmx280mm , paper napkin , dvd , envelope cloth coated 12x16 inch , tube flourescent led cfl , lamp cfl led , paint epoxy alluminium primer , paint coal tar epoxy black , epoxy red oxide primer , paint black heat resistant , paint rfu finishing exterior synthetic dark grey , paint black enamell , paint azure blue , paint alluminium heat resistant , paint olive ...

Due Date : Jun 17, 2024
Tender Value : Ref. Document
View Notice
64

Statutory Bodies & Commissions/Committees - Ernakulam - Kerala

43416768 bids are invited for purchase of paints total quantity : 400

Due Date : Jun 8, 2024
Tender Value : Ref. Document
View Notice
65

Statutory Bodies & Commissions/Committees - Sonitpur - Assam

43416677 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 1000

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
66

Government Departments - Sangareddy - Telangana

43416405 bids are invited for thinner for mould dressing (spirit) total quantity : 6000

Due Date : Jun 8, 2024
Tender Value : rupee 3.24 Lakhs
View Notice
67

Statutory Bodies & Commissions/Committees - Kolar - Karnataka

43416402 bids are invited for 1 fevicol anr 21 in 50 ml 2 aluminium white paint 3 apple green paint 4 enamel black paint 5 golden yellow paint 313-3 6 grey paint 616-4 paint(1ltr tin) 7 no carbo paint 8 paint marker 9 post office red paint 10 signal red paint 520-2 11 pu white paint ( 1 ltr each) 12 thinner for p.u. paints & primer total quantity : 1011

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
68

Statutory Bodies & Commissions/Committees - Kargil - Jammu And Kashmir

43416330 bids are invited for construction joints lime , pu primer nero flor , pu elastomeric joint sealant , bituminous filler board , bituminous 85 slash 25 , retro reflective glass beads thermoplastic paint total quantity : 1585

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
69

Government Departments - Jammu - Jammu And Kashmir

43416294 bids are invited for paint pu paint , black paint , white paint , silver piant , metal primer , thinner , putty total quantity : 195

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
70

Government Departments - Kanchipuram - Tamil Nadu

43414748 bids are invited for light grey polyurethane paint shade no 631 of is 5 , polyurethane thinner total quantity : 700

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
71

Statutory Bodies & Commissions/Committees - North 24 Parganas - West Bengal

43414745 bids are invited for supply of nc paints - etch primer with spray reducer_1isto1 , nc lacquer thinner , nc matt white paint , nc glossy white paint , nc golden yellow paint , epoxy primer with hardener_1isto1 , epoxy thinner , epoxy dulldark grey blue _ hardener total quantity : 26725

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
72

Statutory Bodies & Commissions/Committees - NASHIK - Maharashtra

43414001 bids are invited for varnish ko-085 total quantity : 50

Due Date : Jun 8, 2024
Tender Value : Ref. Document
View Notice
73

Government Departments - bhavnagar - Gujarat

43413267 supply of paint alluminium for general purpose in [paint alluminium for general purpose in dual containers, conforming to is: 2339-2013 with rdso amendment no. 1a (rev. 01 effective from june-2020) as an additional requirement. note: packing in 20 liters nonreturnable new m.s. drums in two pack system.aluminium paste should be supplied inpolythene bags & suspended in aluminium medium in the ms drums.paint alluminium for general purpose in [paint alluminium for general purpose in dual containers...

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
74

Government Departments - Vijayawada - Andhra Pradesh

43413256 supply of white contrast paint in aerosol can as per bs:6072-81 & bs:5044-73 or latest, packing:400ml net content / 500ml can volume.white contrast paint in aerosol can as per bs:6072-81 & bs:5044-73 or latest, packing:400ml net content / 500ml can volume.,white contrast paint in aerosol can as per bs:6072-81 & bs:5044-73 or latest, packing:400ml net content / 500ml can volume. [ warranty period: 30 months after the date of delivery ]

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
75

Government Departments - lallaguda - Telangana

43413207 supply of brush paint and varnish flat size 50 mmbrush paint and varnish flat size 50 mm,brush paint and varnish flat size 50 mm of vulcanized rubber setting type to specification is:384 part 1 :2012 and natural black soft type bristles to is: 1844/93 ( note: four test samples to be supplied by the firm to test th e samples as per procedures attached in the rdso letter no. m&c/pcn/1/42 , nil/09/2004 & 01/10/2004. supply to be made in cotton boxes i.e. 12/16/24 nos. in each box. [ warranty perio...

Due Date : May 29, 2024
Tender Value : Ref. Document
View Notice
76

Government Departments - bhopal - Madhya Pradesh

43412686 supply of brushes 75 mm.brushes 75 mm.,brushes paint and varnish flat size rubber set 75 mm gr.i to is-384/2012 or latest part i and bristl es to is-1844/1993. (1)firm should submit 04 sample before opening of e-tender as per rdso instruction other wise offer will be ignored.(2) item is reserved to be purchased from nsic regd firms only. [ warranty period: 30 months after the date of delivery ]

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
77

Government Departments - bhopal - Madhya Pradesh

43412639 supply of brushes 63mm.brushes 63mm.,brushes paint and varnish flat size 63 mm rubber set confirming to is-384/2012 part-1 or lates t and bristles to is-1844/1993 or latest. note: (1)firm should submit four sample along with their offer as per rds o instructions otherwise offer will be ignored. (2) item is reserved to be purchased from nsic regd. firms only. fi rms to submit the certificate along with their offer otherwise the offer will not be considered. [ warranty period: 30 months after th...

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
78

Government Departments - ernakulam - Kerala

43412378 supply of approved marine paints , supply of marine grade paints with test certificate. , intergard surface tolerant grey , intertuf 262 red primer , interline 850 white , antifouling interspeed 6200 red/brown , intergard 263 tie coat grey , interthane 138 white pu finish , interbond 201 signal green , interthane 138 opaline green , interthane 138 traffic blue / ultra marine blue pu finish , thinner gta 007 , thinner gta 733 , thinner gta 220 , gp thinner 004

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
79

Statutory Bodies & Commissions/Committees - Jalpaiguri - West Bengal

43412204 bids are invited for bamboo 8 ft mse bamboo 8 ft , cgi sheet , laip , burada , spray paint total quantity : 332

Due Date : Jun 8, 2024
Tender Value : Ref. Document
View Notice
80

Statutory Bodies & Commissions/Committees - Palakkad - Kerala

43412019 bids are invited for olive green paint-shade 294 is: 5 (scamic) , heat resistantal. paint , polyurethane finishing paint-jet black , polyurethane zinc-phospate primer , thinner for polyurethane paint , etch primer to def stan 80- 15 is: 5666 total quantity : 39608

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
81

Government Departments - Durg - Chhattisgarh

43411789 bids are invited for m0711110733 paint-primr: 12744 r. o-zn phosp: grey lght , m0719019904 paint cl-rubber: acidalkali res: black total quantity : 1700

Due Date : Jun 8, 2024
Tender Value : rupee 3.78 Lakhs
View Notice
82

Government Departments - Chandrapur - Maharashtra

43411359 Corrigendum : thinner t-200 for pinaka opening date extension from 18 may 2024 to 22 may 2024

Due Date : May 22, 2024
Tender Value : rupee 1.26 Lakhs
View Notice
83

Government Departments - Katihar - Bihar

43410773 bids are invited for itbp head trg items 1 25 brass lancer set with 06 pole and triangle base , venetian fabric cloth satin inspired standard size running meter , jhalar strip as per buyer requirements running meter , decorative ribbon for venetian fabric textured textile , patti for venetian fabric cloth satin inspired patern type embroidered , oxocalcium lime form powder and packing size20 kg , red oxide geru form powder packing size25 kg , agro net green width 2 point5 mtr as per buyer requi...

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
84

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

43410593 bids are invited for paint, rfu, finishing, air drying brushing sprying (q3) total quantity : 7529

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
85

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

43410587 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 13853

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
86

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

43410585 bids are invited for paint, rfu, finishing, air drying brushing sprying (q3) total quantity : 10596

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
87

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

43410574 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 11743

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
88

Government Departments - Kanpur - Uttar Pradesh

43410001 tender for application of anti-corrosive nano coating on 29 nos vrv odu units, only u-bends, header, joints and exposed copper tubes coating including chemical cleaning before coating, capacity 320 hp (2-year warranty after completion of work).

Due Date : May 24, 2024
Tender Value : rupee 2.32 Lakhs
View Notice
89

Government Departments - Thiruvananthapuram - Kerala

43409589 tender for providing aluminum partition in the reception, pharmacy area and internal painting of medical centre at sai lncpe; 1 aluminium works 2 engaging coolie 3 providing aluminium works for doors /partition 4 aluminium for shutters of doors 5 providing 12 mmplpb board lamination on both sides 6 providing glazing in aluminium door 5 mm 7 providing aluminium tubular handle bar 8 painting synthetic enamel paint 9 wall painting with acrylic emulsion two coat

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
90

Government Departments - Jodhpur - Rajasthan

43409491 quotation for consumables (primer kras exon) -1. primer kras exon 2f (gtgtgacatgttctaatatagtca) 2. primer kras exon 2r (gaatggtcctgcaccagtaa) 3. primer kras exon 3f (tcaagtcctttgcccatttt) 4. primer kras exon 3r (tacacaaagaaagccctcccc) 5. primer kras exon 4f (ttgtggacaggttttgaaaga) 6. primer kras exon 4r (agaagcaatgccctctaag)

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
91

Government Departments - mysore - Karnataka

43408986 supply of polyurethane based sealantpolyurethane based sealant,supply of polyurethane based sealant for lhb and vande bharat coaches:- one set consisting of t he following items: 1. primer : sika primer 207 or loctite 8517 or total seal 5028 or 3m or eq uivalent- 2 ltrs 2. adhesive: sika flex 265 or henkel (teroson pu 8590) or total seal (so udaflex 621) or 3m (pu 540)- 29.4 litres 3. 01 nozzle and silicone sealant gun suitable to apply the above adhesive note:- 1. the primer and adhesive shoul...

Due Date : Jun 5, 2024
Tender Value : Ref. Document
View Notice
92

Government Departments - lallaguda - Telangana

43408647 supply of full gloss polyurethane enamel (two pack) for the exterior finishing paint of railway coaches conforming to rdso spec.no.m&c/pcn/100/2018, chapter - v with amendment no. 1b (rev-2.0), blood red colour to ral shade card no. 0303045. packing condition : the material to be supplied in two-pack in ratio of 4:1 i.e. 16liters for enamel and 4liters for hardener (total 20liters supply).full gloss polyurethane enamel (two pack) for the exterior finishing paint of railway coaches conforming to...

Due Date : May 31, 2024
Tender Value : Ref. Document
View Notice
93

Government Departments - Chennai - Tamil Nadu

43408614 supply of enamel, interior finishing paintenamel, interior finishing paint,enamel, interior finishing paint synthetic type to specification is:133- 2013 and to icf/specn.icf/m/d/spec.052, issue status-02 revision-01 smoke grey colour code no.isc-692 of is:5-2007(reaffirmed 2017). [ warranty period: 30 months after the date of delivery ] furnishing tamil nadu 2811.00 litre => limited

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
94

Government Departments - Dahod - Gujarat

43408613 supply of paint enamel interior finishing whitepaint enamel interior finishing white,paint enamel interior finishing white to is 133/04 along with additional req uiremenys stipulated in icf specification icf /md/specx.052 issue status 02 rev 01 pack ed in 20 litres in new and sound non returnable ms drums specn: is: 133/04, is:2552/89gra de b-1 note-material must have supplied along with test cerificates otherwise rejected. [ warranty period: 30 months after the date of delivery ] senior sectio...

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
95

Government Departments - ajmer - Rajasthan

43408611 supply of pu paint top coat in (two pack) chapter v to rdso spec. no. m&c/pcn/100/2018 & amendment no. 1b as an additional requirement . colour shade cream ral 9001pu paint top coat in (two pack) chapter v to rdso spec. no. m&c/pcn/100/2018 & amendment no. 1b as an additional requirement . colour shade cream ral 9001,pu paint top coat in (two pack) chapter v to rdso spec. no. m&c/pcn/100/201 8 & amendment no. 1b as an additional requirement . colour shade cream ral 9001. carriage stores depot r...

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
96

Government Departments - Tirupati - Andhra Pradesh

43408460 supply of anticorrosive solution/anti rust solutioanticorrosive solution/anti rust solutio,anticorrosive solution/anti rust solution in can of 420 ml and in ready to spray.hsn code-3403. m akes: zs 40 or anabond ad 99 or rustlick 631 or wesaf. [ warranty period: 30 months after the date of deliv ery ]

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
97

Government Departments - Dahod - Gujarat

43408368 supply of p.u.paint kit for memu coach(consisting five items) to rdso/specn. no. m&c/pc n/100/2018 as given below- (1) pu paint,colour-pale cream to isc-352 of is-5/1994(two pack syste m)rdso spec.no-m&c/pcn/100/2018 with rdsos amendment no. 1b(rev. 2.0 effective from sept.2020 as a n additional requirement) total qty. per kit 18 ltrs (2) pu paint,colour-air craft blue finish t o isc108 to is-5/1994 (two pack system) rdso spec.no-m&c/pcn/100/2018 with rdsos amendment no. 1b(rev. 2.0 effective ...

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
98

Government Departments - Chennai - Tamil Nadu

43407641 supply of brush paint varnish flat inclined 32 mm to drawing no.icf/j&t/misc/1030/alt g. [ warranty period: 30 months after the date of delivery ] => limited

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
99

Statutory Bodies & Commissions/Committees - kankinara - West Bengal

43405519 spare parts for bd 80 a12 , anabond red (175 gm) part no nk , araldite 175 gm part no nk , cloth emery - 120 part no nk , cloth emery - 60 part no nk , cloth white muslin part no h28305000243 , cotton waste white part no h28305000065 , electrod (n e 900) 4 mm part no 3439000147 , electrod ms 4 mm part no g23439000018 , electrodes welding ms gp2.50 mm part no g23439000016 , halide sheet 0.5 mm part no nk , halide sheet 1 mm part no nk , heavy duty spring washer (aps) part no nk , insulation tape...

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
100

Government Departments - lallaguda - Telangana

43405390 tender for impregnating varnish of elmotherm h-71 a of beck or re 009 of rotomac electricals with suitable thinner for its application. quantity of the thinner shall be 10% of varnish (shelflife item). electric loco shed/lgd, telangana 1918.00 kg

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail