Paints And Primers Tenders from India

349 Paints And Primers tenders are published by various Tendering Authorities & Private companies. 349 live Tender for Paints And Primers are available in Paints And Primers Tender section You can further filter Paints And Primers tenders by Tender Value, Tender Submission Date or Project Location.

Search Result

Government Departments - jhansi - Uttar Pradesh

50009626 supply of paint enamel synthetic exterior signal red finishing to is : 8662/2004 with additional requirements to spec icf/md/spec-045,issue status 02 revision 03

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - lallaguda - Telangana

50009227 supply of petroleum hydrocarbon solvent (thinner), grade - solvent 145/205

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Chamba - Himachal Pradesh

50008459 tender for supply of rod, gi sheet, tiles, angle, pvc pipe, cement,brick,gravel, ceiling sheet, electrical wiring items, jcb cutting, sanitary hardware, paint.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mancheswar - Odisha

50008435 supply of exterior paint finishing - grass green (isc no.218), to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requirements of icf/md/spec-

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

50007552 bids are invited for 1 h-2 8305-000165-casd cloth hessain light 100 cm wide 2 k-5 7920-000016-casd broom sweeping 3 g2 9505-000058 wire steel mild annealed 5.00mm 4 g1 5315-000824 nails steel wire round 75 mm x 2.8 mm 5 h1 c 8030-000047 dubbing o

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

50007353 bids are invited for paint readymixed air drying white semiglossy finish for generalpurpose brushing to specn. is: 168-1993 paint ready mixed air drying white semiglossy finish for , paint ready mixed air drying white total quantity : 830

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Bangalore - Karnataka

50007280 bids are invited for bs2x34 light grey gloss , bs381c-103 , electrical insulating paint total quantity : 60

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

50007164 bids are invited for 1 primers - forward cccctagatgggggaacaga20bp , 2 primers - reversegcattgttctcgggtgcaag 20bp , 3 primers - forward aggcagatggacctggatttga22bp , 4 primers - reversetggcttgcaaatagactcatctcc 24bp , 5 primers - forward gcctggcacatagta

Due Date : Jul 26, 2025

Tender Value :

38 Lakhs

View Notice

Government Departments - ajmer - Rajasthan

50006895 supply of paint ready mixed white finish to is:13607/1992 with amndt. 2, packing in 20 litres non returnable new ms drum.

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Visakhapatanam - Andhra Pradesh

50003709 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 (q3) (( 3 3 2 lakh (s) )) total quantity : 214

Due Date : Jul 16, 2025

Tender Value :

50000.0

View Notice

Government Departments - Bhopal - Madhya Pradesh

50003560 bids are invited for replakyd-519 medium linseed alkyd (60% in m. t. ) or equivalent as per cit-373-21-22-23. , fpo - linseed oil-is:75 varnishes or shellac varnish as per is 347 total quantity : 1500

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Rajauri - Jammu And Kashmir

50002327 bids are invited for synthetic enamel paint ist quality white colour,synthetic enamel paint ist quality black colour,syn total quantity : 431

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jhansi - Uttar Pradesh

50002294 bids are invited for paint finishing matt rfu air drying sand , paint rfu syn spr white , paint rfu green for armoured vehicles , paint air dry br spr syn ena dark grey , paint rfu blue for armoured vehicles , zink paste for armoured vehicles , paint

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

50002092 bids are invited for paint red , paint black , paint white , paint blue , paint yellow , terracotta , lime , geru total quantity : 21700

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kamrup - Assam

50002053 bids are invited for paint bresh 25mm - paint bresh , ms round pipe 25mm x 20ft - ms round pipe , bosch cutting machine 14 inch - cutting machine , bosch hand cutting machine 4 inch - hand cutting machine , black paint , bosch drilling machine - dril

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kargil - Jammu And Kashmir

50002050 bids are invited for 1 f1/10408730/8020-000036/brushes paints and varnishes flat 50 mm 2 g2/10411471/3439-000106/rod welding hard facing 5.00mm 3 h1/10411610/5350-000018/abrasive paper glass is grit 120 size o 4 h5/105463171080-0000641/ec 5 h5/

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Palghar - Maharashtra

50001719 bids are invited for intrguard 263 faj 034 a light grey , interguard 403 red aluminium , interthane 990 signal green phl 549a , interguard 262 red kha 304a , intertuf 262 kha 303a red as a tie coat , interswift 6800 black , interswift 6800 hs bma 684

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kolkata - West Bengal

50001331 bids are invited for washable distemper-is:428 (q3) mse total quantity : 20

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jamnagar - Gujarat

50001316 bids are invited for paint signal red , paint navy blue , paint rfu finishing exterior synthetic dark grey , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 80

Due Date : Jul 19, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jammu - Jammu And Kashmir

50001261 bids are invited for chunna , paint all type , tarpin oil , curtain pipe , paint brush , oic drone wooden name plate , red tape , red foot mat , 8mm ply board , sunmica , moulding patti , hand shaw , hammer , parabolic servo motor , grinder attachmen

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ratlam - Madhya Pradesh

50001151 bids are invited for 1 round domestic casserole 3000 ml capacity , make milton or similar ( as per attached gemc-511687716595533) 2 bone china cup and soucer and tea pot and milk pot sugar pot and tea set ( as per attached gemc-511687716595533) 3

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bilaspur - Chhattisgarh

49999611 wooden court and artistic paint in indoor hall at distirct sports complex,seepat road,bilaspur c.g

Due Date : Jul 16, 2025

Tender Value :

22.31 Lakhs

View Notice

Cooperative - baghpat - Uttar Pradesh

49999460 tender for supply of industrial and decorative burger/universal make paints for year, 2025-26 supply of industrial and decorative burger/universal make paints for year, 2025-26 , synthetic enamelled smoke gray , bus green , black , azure blue , golden yel

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - mumbai - Maharashtra

49998331 tender for supply of eco-friendly paint for idol makers (murtikars) of ganapati idols on pilot basis for ganesh festival 2025 tender id 2025_mcgm_1197133_1

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - gwalior - Madhya Pradesh

49994802 supply of ready mixed paint

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kalyan - Maharashtra

49992769 supply of spray paint aerosol can

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhopal - Madhya Pradesh

49992596 bids are invited for replakyd-519 medium linseed alkyd (60% in m. t. ) or equivalent as per cit-373-21-22-23. , fpo - linseed oil-is:75 varnishes or shellac varnish as per is 347 total quantity : 1500

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - kalpakkam - Tamil Nadu

49990549 tender for varnishes or shellac varnish as per is 347 (q3) , liquid soap dispenser (v2) (q3)

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989769 supply of pu paint black (two packs)

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989682 supply of pu paint pale cream

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Valsad - Gujarat

49989541 supply of pu paint signal white ral-9003 as per rdso

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989529 supply of pu post office red paint

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ajmer - Rajasthan

49989393 supply of pu white paint to ral-9010

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kharagpur - West Bengal

49989379 supply of paint gentian blue (ral-5010) pu based. matl.& specn : rdso specification no. m&c pc n/109/2020 with amendment no. 1b (rev. 2.0) as an additional requirement.

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - cuttack - Odisha

49988501 supply of paint red oxide zinc chrome primer, to drawing / specification is:2074/(part-1)/2015, along with icf spec. icf/m/d spec.045, issue status 02, rev.03 dated 14.06.2007 and rdso amendment no. 1a as an additional requirement.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - visakhapatnam - Andhra Pradesh

49988442 supply of paint enamel synthetic exterior - white finishing, to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requirements of icf/md/spec-04

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - raiwala - Uttarakhand

49988056 tender for periodical services in zone a under age (i) raiwala

Due Date : Jul 26, 2025

Tender Value :

10 Lakhs

View Notice

Government Departments - goa - Goa

49986798 bids are invited for black colouring formetal , blue , yellow , red , white calcimine , grey apex , white , brown , green , dark blue , paint brush 3inch , paint brush 2inch , luxul stainer 200ml , touch wood , thinner total quantity : 420

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Chamoli - Uttarakhand

49986101 bids are invited for supply of paints & primer to vishnugad project in , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 1

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Amritsar - Punjab

49985833 bids are invited for paint - duco paint olive green , paint - duco paint black , paint - duco paint red oxide metal primer , paint - duco thinner , paint - asian bus green , paint - asian black , paint - asian paint golden brown , paint - asian paint

Due Date : Jul 22, 2025

Tender Value :

5 Lakhs

View Notice

Government Departments - Visakhapatnam - Andhra Pradesh

49985503 bids are invited for steel polish liquid , acrylic liquid , glossy polish , shoe polish liquid as per is 12010 total quantity : 930

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kanpur - Uttar Pradesh

49984044 tender for paint supply and application of paint on chimney shell, construction of cems room, external platforms, effluent tank and other miscellaneous civil works in chimney

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kanpur Nagar - Uttar Pradesh

49982256 bids are invited for paint rfu finishing stoving amnsc finish spraying , ready mixed paint, finishing, interior for general purposes - is 3537 total quantity : 1383

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - GARHARA - Bihar

49981704 supply of paint enamel synthetic exterior finishing signal red.

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bilaspur - Uttar Pradesh

49981475 tender for supply of industrial and decorative paints for season 2025-26 - supply of industrial and decorative paints 2 primmer (red oxide) 3 thinner 4 aluminium (paste+ thinner) 5 black head resistance paint 6 bus green 7 post office red 8

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kalyan - Uttar Pradesh

49980311 Corrigendum : tender for agreement for procurement of materials/goods for chief minister mass marriage scheme. - 1) sarees-05 nos. (5.50 meters each including blouse). 01 nos. bridal saree/lehenga. 02 nos. embroidered sarees. 02 nos. printed sarees of best quality.

Due Date : Jul 23, 2025

Tender Value : Ref. Document

View Notice

Cooperative - Palakkad - Kerala

49978546 tender for construction of a partitioning room in fpg for storage of milmamin packets and ksheeravardhini buckets

Due Date : Jul 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jagadhri - Haryana

49974589 supply of synthetic enamel finish coat shade

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Harnaut - Bihar

49974515 supply of paint enamel synthetic golden yellow.........

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Chengalpattu - Tamil Nadu

49973848 bids are invited for varnishes or shellac varnish as per is 347 (q3) , liquid soap dispenser (v2) (q3) mse total quantity : 120

Due Date : Jul 24, 2025

Tender Value :

49323.0

View Notice

Statutory Bodies & Commissions/Committees - Medinipur East - West Bengal

49973750 bids are invited for interthane 990 grey light grey , turpentine oil solvent , paint signal red , paint red oxide , paint yellow zinc chromate , paint golden yellow , paint dark grey , paint black enamel , paint azure blue , distemper white total qua

Due Date : Jul 14, 2025

Tender Value :

1.83 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Tiruvallur - Tamil Nadu

49973521 bids are invited for , varnishes or shellac varnish as per is 347 total quantity : 8560

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mancheswar - Odisha

49972314 supply of paint synthetic enamel brushing exterior, signal red finishing (isc no-537), to drawing / specification is:8662/2024, rdso amendment no. 1 (revision - 0) for pigment content as an additional requirement to is:8662-2024, with additional requ

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jaipur - Rajasthan

49971509 tender for supply of colour paint roller blind with motor & remote, glass fixing etc

Due Date : Jul 8, 2025

Tender Value :

2 Lakhs

View Notice

Government Departments - secUNDERABAD - Telangana

49971216 supply of insulation paint-42kv high insulation paint for insulation purpose. as per rdso specification-ti0lko/78/2020. :make:- insulect sk-03/ casewell or similar

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ponmalai - Tamil Nadu

49969046 supply of paint enamel synthetic exterior

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Koraput - Odisha

49968409 bids are invited for varnish ko-08 total quantity : 130

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Gurdaspur - Punjab

49968387 bids are invited for runner matt , comforter set , grass matt , king size cotton bed sheet , blanket , 33 x 4 ft green turf matt , blue star mini fridge , 8 mtr x 3 mtr black tape , soap dispenser , pipe steel , bracket , finials , corner , soap disp

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - ajmer - Rajasthan

49966627 supply of pu paint top coat in (two pack) chapter v to rdso spec. no. m&c/pcn/100/2018 & amendment no. 1b as an additional requirement . colour shade cream ral 9001.

Due Date : Sep 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - izzatnagar - Uttar Pradesh

49966625 supply of red insulated varnish h class epoxy insulation protection coating for winding cable

Due Date : Aug 8, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jabalpur - Madhya Pradesh

49965972 bids are invited for paint ready mixed ammunation stoving semi-glossy , ready mixed paint, finishing, interior for general total quantity : 553

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Rupnagar - Punjab

49965856 bids are invited for washable distemper-is:428 (q3) , white cement based polymeric putty as per is 17545 (q3) , bitumen primer for use in waterproofing and damp - proofing as per is 3384 (q3) mse total quantity : 55

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Indore - Madhya Pradesh

49965580 bids are invited for ready mixed paint, air drying, red oxide zinc chrome, priming (v2) as per is 2074 (q3) , emery cloth (q3) mse total quantity : 135

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ratnagiri - Maharashtra

49965453 tender for supplying and applying anti-corrosive paintting to rail surface inside tunnels in ratnagiri regionsupplying and applying anti-corrosive paintting to rail surface inside tunnels in ratnagiri region,

Due Date : Jul 24, 2025

Tender Value :

20.86 Lakhs

View Notice

Government Departments - Kharagpur - West Bengal

49965345 supply of varnish for coil moulding as per rdso specn. no. mpmi no. 153/92 (revision-04) september, 2014.shelf life of the item is 24 months.

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jhansi - Uttar Pradesh

49965214 supply of finishing anti-tracking varnish

Due Date : Aug 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - jodhpur - Rajasthan

49964859 supply of paint enamel synthetic exterior brushing undercoat colour blood red/maroon ral shade card no. 0303045 to is -8662/2024 , with additional requirements stipulated in icf spec. icf/md/spec.-045, status 02 rev.-03

Due Date : Jul 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - bhavnagar - Gujarat

49964021 supply of paint alluminium

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pithoragarh - Uttarakhand

49963016 bids are invited for supply of 3d printed reinforced concrete panels along with steel lintels - supply of 3d printed reinforced concrete panels along with steel lintels as per specifications and drawings mentioned in technical specification document

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chennai - Tamil Nadu

49963013 bids are invited for interthane 990 (phb 000pha 046) white , paint interguard , marine paints total quantity : 180

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jalgaon - Maharashtra

49963010 bids are invited for , washable distemper-is:428 total quantity : 1000

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Uttara Kannada - Karnataka

49962939 bids are invited for epoxy based anti corr paint for application in ballast tank(n8010-p009679) , intumescent fire retardant paint(n8010-p009745) , penguard , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 293

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Uttara Kannada - Karnataka

49962905 bids are invited for paint, rfu, priming aluminium, water resistant, brushingspray(n8010-000114) , varnish black japan(n8010-000270) , epoxy red oxide primer(n8010- 001009) , paint rfu finishing gen. ser. synth. semi , epoxy grout total quantity : 39

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Uttara Kannada - Karnataka

49962900 bids are invited for paint non slip epoxy d. a grey with hardner (n8010- , enamel, synthetic, exterior (a) under coating (b) finishing paint (v3) confirming to is 2932 total quantity : 24060

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - delhi - Delhi

49960310 tender for misc civil repair work in qtr no. 713 at p and t colony rk puram.

Due Date : Jul 8, 2025

Tender Value :

2.95 Lakhs

View Notice

Government Departments - visakhapatnam - Andhra Pradesh

49955108 supply of (for vande bharat trainset) supply of pr [(for vande bharat trainset) supply of primer for vb coaches (suitable between 5 to 48 deg.celcius temp) in packing of 1000ml make brand sika primer 210 of m/s sika or teroson pu 8517h of m/s henkel

Due Date : Aug 1, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Prayagraj - Uttar Pradesh

49954272 bids are invited for h1 a8010-007494 paint rfu fin syn ena br spr gold yellow - paint rfu fin syn ena br/spr gold yellow , g1 5340-003617 seals metallic lead 10mm - seals metallic lead 10mm , g2 9520-000004 steel angles 30x30x3 mm - steel angles 30x3

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Bangalore - Karnataka

49952607 bids are invited for r600159200 - epoxy primer , r605111408 - hardener for epoxy primer , r600136700 - epoxy thinner for primer , r605159500 - pu finish paint , r605111410 - hardener for finish paint , r605112800 - polyurethane thinner , r608009000 -

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

49952527 bids are invited for nano thinner for industrial paint. flash point 30+ - , thinner for epoxy paints (bhel) total quantity : 800

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Balaghat - Madhya Pradesh

49952484 bids are invited for varnishes or shellac varnish as per is 347 (q3) mse total quantity : 80

Due Date : Jul 23, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Durg - Chhattisgarh

49952462 bids are invited for yellow paint 4 letre pack , red paint 4 letre pack , smoke grey paint 4 letre pack , black paint 4 letre pack , aluminium paint 4 letre pack , blue paint 4 letre pack , red oxide primer 20 letre pack total quantity : 24

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

49952258 bids are invited for fiber duster brush , fluorescent tape for night marking of emergency ways , baygon spray , synthetic liquid detergent for industrial purpose , bucket plastic 15 ltrs capacity , grease lg 200 , funnel 5 , cloth emery bs 871 or 61

Due Date : Jul 23, 2025

Tender Value :

4.20 Lakhs

View Notice

Government Departments - patiala - Punjab

49950836 supply of cellulose nitrate based thinner

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Vijayawada - Andhra Pradesh

49950790 supply of 1) salmon pink paint isc-443 to is :8662/2001 or latest. & 2) sky blue paint isc-101 to is:8662/2004 or latest.

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Jammu - Jammu And Kashmir

49950180 bids are invited for 1 masking tape 1.5 inch 60 meter 2 masking tape 2 inch 60 meter 3 clear 2k 4 2k polyster putty 5 duco paint mirage blue 6 2k hardner 7 2k thinner 8 duco paint yellow 9 duco paint dove grey automoive 10 duco paint a

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

49949919 bids are invited for paint white , paint gray , paint red , paint epoxy , paint black , paint yellow , paint blue , mek , glycerin , window shield was liquid , teflon tape , paint remover , araldite , corrosion prevention spray , white sprit , thinne

Due Date : Jul 9, 2025

Tender Value :

80240.0

View Notice

Boards / Undertakings / PSU - Rampur - Uttar Pradesh

49949656 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing , gum spirit of turpentine oil as per is 533 total quantity : 9213

Due Date : Jul 16, 2025

Tender Value :

44.10 Lakhs

View Notice

Government Departments - lucknow - Uttar Pradesh

49947341 supply of enamel synthetic, exterior, finishing, middle brunswick green

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Parel - Maharashtra

49947222 supply and application of paint with fleet graphic film for all types of lhb coaches at loco workshop, parel

Due Date : Jul 22, 2025

Tender Value :

4.13 Crore

View Notice

Government Departments - kolkata - West Bengal

49947188 supply of polypropylene blue - monofilament 7/0 etc.

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Pune - Maharashtra

49946615 tender for purchase of paint and paint material for pmc vehicles , synthetic enamel golden yellow 1st quality , 4 litre pack , 20 litre pack , black japan (chota jawan) 20 ltr , synthetic enamel black 1st quality4 ltr pack , synthetic enamel white 1st qua

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - malda - West Bengal

49946403 supply of supply of paint.

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - lallaguda - Telangana

49946380 supply of paint enamel smoke grey

Due Date : Aug 1, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Pune - Maharashtra

49942620 tender for providing powder coated with structural steel for store shed and office at agriculture research station, wadgaon maval, dist: pune .

Due Date : Jul 9, 2025

Tender Value :

2.03 Lakhs

View Notice

Government Departments - visakhapatnam - Andhra Pradesh

49942244 bids are invited for repair and overhauling service - rate contract for application of anti corrosive and non skid paint scheme onboard in vessels; any other suitable brand; no; buyer premises mopping/degreasing and high pressure fresh water jetting to

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - narela - Delhi

49941247 tender for m/o completed scheme under narela zone.

Due Date : Jul 9, 2025

Tender Value :

38.54 Lakhs

View Notice

Cooperative - palacode - Tamil Nadu

49940081 tender for purchase of paints

Due Date : Jul 7, 2025

Tender Value :

20000.0

View Notice

Statutory Bodies & Commissions/Committees - Porbandar - Gujarat

49937328 bids are invited for , marine paints total quantity : 40

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - perambur - Tamil Nadu

49935113 supply of paint.

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

100

Government Departments - bhopal - Madhya Pradesh

49934861 supply of black japan paint type b packing in 20 liters new non-returnable m.s. drum to is specn. no. 341/2016 second revision.

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Top