PCR And RT PCR Products Tenders from India

74 PCR And RT PCR Products tenders are published by various Tendering Authorities & Private companies. 74 live Tender for PCR And RT PCR Products are available in PCR And RT PCR Products Tender section You can further filter PCR And RT PCR Products tenders by Tender Value, Tender Submission Date or Project Location.

1

Government Departments - jammu - Jammu And Kashmir

49679739 tender for supply of automated viral rna extraction kits

Due Date : Jun 26, 2025
Tender Value : Ref. Document
View Notice
2

Boards / Undertakings / PSU - Delhi - Delhi

49673477 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 10 lakh (s) total quantity : 1

Due Date : Jun 27, 2025
Tender Value : Ref. Document
View Notice
3

Statutory Bodies & Commissions/Committees - pune - Maharashtra

49658952 tender for superscript iii one step rt pcr

Due Date : Jun 18, 2025
Tender Value : rupee 8.70 Lakhs
View Notice
4

Government Departments - jhajjar - Haryana

49658507 tender for supply, installation, testing and commissioning of multiblock high throughput real time pcr

Due Date : Jul 14, 2025
Tender Value : rupee 20 Lakhs
View Notice
5

Government Departments - Chennai - Tamil Nadu

49646776 bids are invited for , real time pcr kits (v2) total quantity : 20

Due Date : Jul 4, 2025
Tender Value : Ref. Document
View Notice
6

Government Departments - Ahmedabad - Gujarat

49645403 bids are invited for automated real time micro pcr machine (q2) ( pac only ) mse total quantity : 180

Due Date : Jun 23, 2025
Tender Value : Ref. Document
View Notice
7

Government Departments - lucknow - Uttar Pradesh

49623180 tender for supply of real time pcr kit

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
8

Government Departments - Mumbai Suburban - Maharashtra

49622999 bids are invited for l-buthionine-sulfoximine , ferrostatin-1 , mito-trfs , fast- , oligonucleotides pcr primer total quantity : 8

Due Date : Jul 2, 2025
Tender Value : Ref. Document
View Notice
9

Boards / Undertakings / PSU - Multi State

49616929 tender for desalted oligo nucleotide 5od 100 nmol pcr product dna/plasmid sequencing services upto 1400 bases with gel purification

Due Date : Jun 19, 2025
Tender Value : Ref. Document
View Notice
10

Boards / Undertakings / PSU - Pondicherry - Puducherry

49610683 supply of evaluation of real-time pcr assay for detection of vancomycin resistant enterococcus species directly from positively flagged blood culture bottle

Due Date : Jun 25, 2025
Tender Value : Ref. Document
View Notice
11

Government Departments - Thiruvananthapuram - Kerala

49603844 bids are invited for primers desalted oligonucleotides mse primers dedalted oligonucleotides , tri-glycine sds running , oligonucleotides pcr primer total quantity : 521

Due Date : Jul 2, 2025
Tender Value : Ref. Document
View Notice
12

Government Departments - raipur - Chhattisgarh

49601817 supply of respiratory syncytial virus (rsv) real time pcr kit

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
13

Government Departments - Mumbai - Maharashtra

49598715 bids are invited for consumables mse quagen multiplex pcr kit100 cat.no 206143 , dimethyl sulfoxide molecular grade cat.no d8418-50 ml. sigma , primer lis-f 5ataccatgg tta ccc cat tgagc3 , primer lis-r 5agggctcattacatgtggaccc3 , primer 4.2-f 5ggtttac

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
14

Boards / Undertakings / PSU - new Delhi - Delhi

49590836 procurement of consumables make m/s qiagen gmbh, germany , 1. therascreen kras rgq pcr kit (24) v1 (cat. no. #874011) 2. qiaamp dna ffpe kit (50) (cat. no. # 56404) 3. qiaamp rna blood mini kit (50) (cat. no. 52304) 4. quanti nova sybr gree

Due Date : Jun 30, 2025
Tender Value : Ref. Document
View Notice
15

Government Departments - Jamnagar - Gujarat

49585011 bids are invited for covid-19 rtpcr test kit , influenza abh1n1h3n2 multiplex rt-pcr kit , viral transport medium kit , viral , anti - sars cov - 2 / covid - 19 elisa testing kit total quantity : 36960

Due Date : Jul 3, 2025
Tender Value : Ref. Document
View Notice
16

Government Departments - Delhi - Delhi

49579662 bids are invited for rt2 first strand kit , rt2 sybr green qpcr mastermix , rt2 , real time pcr kits (v2) total quantity : 4

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
17

Statutory Bodies & Commissions/Committees - Karnal - Haryana

49577605 bids are invited for real time pcr kits (v2) (q2) mse total quantity : 1920

Due Date : Jun 20, 2025
Tender Value : Ref. Document
View Notice
18

Government Departments - Thiruvananthapuram - Kerala

49574885 supply of laboratory consumables , one step rt-pcr kit -500 reactions => limited

Due Date : Jun 17, 2025
Tender Value : Ref. Document
View Notice
19

Government Departments - bhopal - Madhya Pradesh

49573258 tender for online rate contract tender for supply of covid consumables and kits to various hospitals of government of madhya pradesh for a period of 18 months , consumables items , 0.2 ml pcr tube with attached cap (sterile, rnase/ dnase free, flat-c

Due Date : Jun 30, 2025
Tender Value : Ref. Document
View Notice
20

Government Departments - egmore - Tamil Nadu

49571404 online tender for fixing rate contract for supply of rtpcr- plate and rtpcr-sealer to various govt. institutions

Due Date : Jun 19, 2025
Tender Value : Ref. Document
View Notice
21

Government Departments - egmore - Tamil Nadu

49571395 tender for online tender for fixing rate contract for supply of multiplex rtpcr kits (respiratory panel) to various govt. institutions

Due Date : Jun 19, 2025
Tender Value : Ref. Document
View Notice
22

Government Departments - trombay - Maharashtra

49571045 tender for supply, installation, warranty and training of multiplex, nested pcr filmarray system as per detailed specifications given in annexure -1 (technical specifications)

Due Date : Jun 30, 2025
Tender Value : Ref. Document
View Notice
23

Statutory Bodies & Commissions/Committees - Rajouri - Jammu And Kashmir

49568425 bids are invited for naat based pcr test kit (q2) (( 3 3 3 lakh (s) )) total quantity : 150

Due Date : Jun 30, 2025
Tender Value : Ref. Document
View Notice
24

Statutory Bodies & Commissions/Committees - Rajouri - Jammu And Kashmir

49568424 bids are invited for micro pcr mtb test kit (q3) (( 3 3 3 lakh (s) )) total quantity : 150

Due Date : Jun 30, 2025
Tender Value : Ref. Document
View Notice
25

Government Departments - Bengaluru Urban - Karnataka

49568007 bids are invited for , qualitative pcr machine (thermal cycler) total quantity : 2

Due Date : Jun 30, 2025
Tender Value : Ref. Document
View Notice
26

Statutory Bodies & Commissions/Committees - Jorhat - Assam

49567605 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 5 lakh (s) total quantity : 1

Due Date : Jun 30, 2025
Tender Value : Ref. Document
View Notice
27

Boards / Undertakings / PSU - delhi - Delhi

49567428 tender for procurement of consumables make ms qiagen gmbh germany

Due Date : Jun 30, 2025
Tender Value : rupee 7.70 Lakhs
View Notice
28

Statutory Bodies & Commissions/Committees - Gurgaon - Haryana

49565469 bids are invited for real time pcr kits (v2) (q2) mse total quantity : 2000

Due Date : Jun 19, 2025
Tender Value : rupee 5 Lakhs
View Notice
29

Government Departments - Mumbai Suburban - Maharashtra

49560365 bids are invited for biorad items mse 4 to 15 percent mini protean tgx precast protein gels, 12 well, 20 microliter biorad 4561085 , 4 to 15 percent mini protean tgx precast protein gels, 15 well, 15 microliter biorad 4561086 , immun blot pvdf membra

Due Date : Jul 1, 2025
Tender Value : Ref. Document
View Notice
30

Statutory Bodies & Commissions/Committees - Jalandhar - Punjab

49547972 bids are invited for right ear cap assy , dynamic microphone , left earcap , automated real time micro pcr machine total quantity : 36

Due Date : Jun 30, 2025
Tender Value : Ref. Document
View Notice
31

Government Departments - Thiruvananthapuram - Kerala

49544352 tender for supply of laboratory consumables

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
32

Government Departments - Gandhinagar - Gujarat

49535350 bids are invited for , automated real time micro pcr machine total quantity : 1

Due Date : Jun 28, 2025
Tender Value : Ref. Document
View Notice
33

Statutory Bodies & Commissions/Committees - Karnal - Haryana

49528005 bids are invited for real time pcr kit for sars - cov - 2 covid - 19 (q2) mse total quantity : 960

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
34

Government Departments - Lucknow - Uttar Pradesh

49513205 Corrigendum : bids are invited for real time pcr kits (v2) (q2) ((3 3 )) 5 lakh (s) total quantity : 200000

Due Date : Jun 21, 2025
Tender Value : rupee 15.10 Lakhs
View Notice
35

Government Departments - Dhamtari - Chhattisgarh

49513042 bids are invited for naat based pcr test kit (q2) ((3 3 )) 1 lakh (s) total quantity : 175

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
36

Boards / Undertakings / PSU - Lucknow - Uttar Pradesh

49511465 procurement of following item on proprietary/single cepheid xpert cbnaat mtb/rif ultra pcr test kit

Due Date : Jun 20, 2025
Tender Value : Ref. Document
View Notice
37

Government Departments - Gandhinagar - Gujarat

49509386 Corrigendum : bids are invited for real time pcr kit for sars - cov - 2 covid - 19 (q2) ((3 3 )) 3 lakh (s) total quantity : 50000

Due Date : Jun 17, 2025
Tender Value : rupee 6 Lakhs
View Notice
38

Government Departments - Mumbai Suburban - Maharashtra

49507519 bids are invited for , micro pcr mtb test kit total quantity : 2

Due Date : Jun 26, 2025
Tender Value : Ref. Document
View Notice
39

Government Departments - Solapur - Maharashtra

49502427 bids are invited for , real time pcr machine total quantity : 1

Due Date : Jun 26, 2025
Tender Value : Ref. Document
View Notice
40

Local Bodies - Gorakhpur - Uttar Pradesh

49494254 bids are invited for real time pcr machine (v2) (q2) ((3 3 )) 9 lakh (s) total quantity : 1

Due Date : Jun 23, 2025
Tender Value : Ref. Document
View Notice
41

Government Departments - Thiruvananthapuram - Kerala

49485018 tender for supply of one step rt pcr kit

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
42

Boards / Undertakings / PSU - delhi - Delhi

49470191 tender for procurement of go taq qpcr master mix cat no a6001 make ms promega corporation usa

Due Date : Jun 23, 2025
Tender Value : rupee 1.47 Lakhs
View Notice
43

Local Bodies - Pune - Maharashtra

49457632 bids are invited for real time pcr machine (v2) (q2) ( pac only ) total quantity : 1

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
44

Government Departments - Delhi - Delhi

49447571 bids are invited for naat based pcr test kit (q2) ( pac only ) total quantity : 500

Due Date : Jun 23, 2025
Tender Value : Ref. Document
View Notice
45

Government Departments - Delhi - Delhi

49447570 bids are invited for micro pcr mtb test kit (q3) ( pac only ) , micro pcr mtb rif dx test kit (q3) ( pac only ) total quantity : 800

Due Date : Jun 23, 2025
Tender Value : Ref. Document
View Notice
46

Government Departments - Samba - Jammu And Kashmir

49415794 bids are invited for real time pcr machine (v2) (q2) total quantity : 1

Due Date : Jun 27, 2025
Tender Value : Ref. Document
View Notice
47

Statutory Bodies & Commissions/Committees - Delhi - Delhi

49411065 bids are invited for rfp 25 pathology truenat mtb plus , truenat mtbrif dx , truenat hcv , truenat hbv , truenat h3n2orh1n1 , truenat hpvhr , truenat hiv1orhiv2 , truenat hlab27 truenat mtb plus, truenat mtb-rif dx, truenat hcv, , micro pcr mtb test

Due Date : Jun 20, 2025
Tender Value : Ref. Document
View Notice
48

Government Departments - Chandigarh - Chandigarh

49394113 tender for supply of item:- real-time pcr with accessories and consumables

Due Date : Jun 20, 2025
Tender Value : Ref. Document
View Notice
49

Government Departments - bhopal - Madhya Pradesh

49392305 Corrigendum : tender for online rate contract tender for supply of covid consumables and kits to various hospitals of government of madhya pradesh for a period of 18 months , consumables , rt pcr kit for covid-19 , column-based viral rna extraction kit from cell-f

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
50

Government Departments - Kamrup Metro - Assam

49389745 bids are invited for thermal cycler thermal cycler , ups , warrenty , installtion , training , qualitative pcr machine (thermal cycler) total quantity : 5

Due Date : Jun 19, 2025
Tender Value : Ref. Document
View Notice
51

Government Departments - jammu - Jammu And Kashmir

49375285 Corrigendum : tender for supply of respiratory pathogen panel pcr kit

Due Date : Jun 26, 2025
Tender Value : Ref. Document
View Notice
52

Government Departments - jammu - Jammu And Kashmir

49375279 Corrigendum : tender for supply of adenovirus pcr kit

Due Date : Jun 26, 2025
Tender Value : Ref. Document
View Notice
53

Government Departments - jammu - Jammu And Kashmir

49375174 Corrigendum : tender for supply of qualitative rt-pcr kits

Due Date : Jun 26, 2025
Tender Value : Ref. Document
View Notice
54

Government Departments - jammu - Jammu And Kashmir

49375169 Corrigendum : tender for supply of viral transport medium ,2 viral rna extraction kit, qualitative rt-pcr kits

Due Date : Jun 26, 2025
Tender Value : Ref. Document
View Notice
55

Government Departments - South Andamans - Andaman And Nicobar Islands

49346929 Corrigendum : bids are invited for real time pcr kits (v2) (q2) total quantity : 1

Due Date : Jun 17, 2025
Tender Value : Ref. Document
View Notice
56

Government Departments - Dehradun - Uttarakhand

49346858 bids are invited for automated real time micro pcr machine (q2) total quantity : 30

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
57

Government Departments - Mumbai Suburban - Maharashtra

49346743 bids are invited for transcriptor reverse transcriptase 2000u (cat no. 3531287001 of roche) , real time pcr kit for sars - cov - 2 / covid - 19 real time pcr kits (v2) total quantity : 4

Due Date : Jun 20, 2025
Tender Value : Ref. Document
View Notice
58

Government Departments - Kasaragod - Kerala

49331975 bids are invited for whole genome sequencing of insect , taq dna polymerase total quantity : 300

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
59

Government Departments - Lucknow - Uttar Pradesh

49274583 Corrigendum : bids are invited for automated real time micro pcr machine (q2) total quantity : 422

Due Date : Jun 17, 2025
Tender Value : Ref. Document
View Notice
60

Government Departments - South Andamans - Andaman And Nicobar Islands

49269137 bids are invited for oligonucleotides pcr primer and probes inf a cdc f , inf a cdc r , inf b cdc f , inf b cdc r , cov2 cdc f , cov2 cdc r , actin f , actin r , 3pdenv-f , 3pdenv-r1-3 , 3pdenv-r4 , chik f , chik r , adenovirus f , adenovirus r , pan

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
61

Government Departments - Kottayam - Kerala

49251150 Corrigendum : bids are invited for synthesis of oligos , oligonucleotides pcr primer total quantity : 10000

Due Date : Jun 18, 2025
Tender Value : Ref. Document
View Notice
62

Government Departments - Gautam Buddha Nagar - Uttar Pradesh

49239193 Corrigendum : bids are invited for thermal cycler , qualitative pcr machine (thermal cycler) total quantity : 2

Due Date : Jun 24, 2025
Tender Value : rupee 10 Lakhs
View Notice
63

Government Departments - Gautam Buddha Nagar - Uttar Pradesh

49239191 Corrigendum : bids are invited for real time pcr machine (v2) (q2) total quantity : 1

Due Date : Jun 24, 2025
Tender Value : rupee 25 Lakhs
View Notice
64

Statutory Bodies & Commissions/Committees - Delhi - Delhi

49209709 Corrigendum : bids are invited for respiratory pathogen panel rtpcr kit with extraction kit , disease specific real time pcr kits real time pcr kits (v2) total quantity : 2

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
65

Government Departments - Mumbai Suburban - Maharashtra

49157893 Corrigendum : bids are invited for fast sybr green mix, abi code: 4385610 , pcr master mix real time pcr kits (v2) total quantity : 1

Due Date : Jun 23, 2025
Tender Value : Ref. Document
View Notice
66

Government Departments - Mumbai Suburban - Maharashtra

49157885 Corrigendum : bids are invited for vetmax plus one-step rt-pcr kit, abi cat. no: 4415328 , pcr master mix real time pcr kits (v2) total quantity : 2

Due Date : Jun 23, 2025
Tender Value : Ref. Document
View Notice
67

Government Departments - Mumbai Suburban - Maharashtra

49157857 Corrigendum : bids are invited for taqman fast universal pcr master mix, abi cat. no: 4352042 , pcr master mix real time pcr kits (v2) total quantity : 2

Due Date : Jun 23, 2025
Tender Value : Ref. Document
View Notice
68

Government Departments - Mumbai Suburban - Maharashtra

49157753 Corrigendum : bids are invited for premix taq (qpcr mix) , takara code: rr390a , pcr master mix real time pcr kits (v2) total quantity : 2

Due Date : Jun 23, 2025
Tender Value : Ref. Document
View Notice
69

Boards / Undertakings / PSU - Ghazipur - Uttar Pradesh

49136779 Corrigendum : bids are invited for automated real time micro pcr machine (q2) total quantity : 2

Due Date : Jun 19, 2025
Tender Value : rupee 40 Lakhs
View Notice
70

Government Departments - Bilaspur - Himachal Pradesh

49069550 Corrigendum : bids are invited for real time pcr machine (v2) (q2) total quantity : 2

Due Date : Jun 19, 2025
Tender Value : Ref. Document
View Notice
71

Statutory Bodies & Commissions/Committees - Delhi - Delhi

49062773 Corrigendum : bids are invited for flu panel with rsv detection , real time pcr kits (v2) total quantity : 1

Due Date : Jun 16, 2025
Tender Value : Ref. Document
View Notice
72

Government Departments - bhopal - Madhya Pradesh

49043721 Corrigendum : tender for supply, installation, testing and commissioning for real time pcr machine

Due Date : Jun 17, 2025
Tender Value : Ref. Document
View Notice
73

Government Departments - Delhi - Delhi

47878823 Corrigendum : bids are invited for real time pcr machine , real time pcr kits (v2) total quantity : 3

Due Date : Jun 20, 2025
Tender Value : Ref. Document
View Notice
74

Government Departments - Jodhpur - Rajasthan

47515310 Corrigendum : bids are invited for real time pcr machine (q2) total quantity : 1

Due Date : Jun 24, 2025
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail