Nucleic Acid Extraction Kits Tenders from India

17 Nucleic Acid Extraction Kits tenders are published by various Tendering Authorities & Private companies. 17 live Tender for Nucleic Acid Extraction Kits are available in Nucleic Acid Extraction Kits Tender section You can further filter Nucleic Acid Extraction Kits tenders by Tender Value, Tender Submission Date or Project Location.

1

Government Departments - Delhi - Delhi

50007164 bids are invited for 1 primers - forward cccctagatgggggaacaga20bp , 2 primers - reversegcattgttctcgggtgcaag 20bp , 3 primers - forward aggcagatggacctggatttga22bp , 4 primers - reversetggcttgcaaatagactcatctcc 24bp , 5 primers - forward gcctggcacatagta

Due Date : Jul 26, 2025
Tender Value : rupee 38 Lakhs
View Notice
2

Boards / Undertakings / PSU - Amritsar - Punjab

49989705 tender for quick-rna miniprep plus kit (200 preps) w/zymo-spin iiicg columns (capped) & spin-away filters cat. no. r1058-qty 01, zymobiomics dna miniprep kit (50 preps) cat. no. d4300 - qty 04

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
3

Government Departments - Amreli - Gujarat

49987414 bids are invited for plasmid kits (q3) ((3 3 )) 2 lakh (s) total quantity : 1

Due Date : Jul 25, 2025
Tender Value : Ref. Document
View Notice
4

Government Departments - South Andamans - Andaman And Nicobar Islands

49985523 bids are invited for forensic dna extraction kit (q3) ( pac only ) ((3 3 )) 1 lakh (s) total quantity : 3

Due Date : Jul 14, 2025
Tender Value : Ref. Document
View Notice
5

Government Departments - kolkata - West Bengal

49964546 tender for adenovirus rt-pcr kit. (100 reaction) along with dna extraction kit. (100 reaction)

Due Date : Jul 15, 2025
Tender Value : Ref. Document
View Notice
6

Government Departments - Mumbai - Maharashtra

49954375 bids are invited for bdt v3 1 rr-100 , pop7-3730 by 3730xl dna analyzers , genescan tm 500 liz dye size standard 800 rnxs , hidi formamide 25ml , tube-5x seq buffer small total quantity : 5

Due Date : Jul 24, 2025
Tender Value : Ref. Document
View Notice
7

Local Bodies - Mahendragarh - Haryana

49949959 bids are invited for title2 - cuvette , title3 - resazurin sodium , title5 - alamarblue hs cell viability reagents , title6 - dimethyl sulphoxide , title7 - carbinol hplc , title8 - mtt , title9 - 96 well plate , title10 - todd hewitt broth , title11

Due Date : Jul 23, 2025
Tender Value : Ref. Document
View Notice
8

Government Departments - Khordha - Odisha

49861273 bids are invited for genejet viral rna dna purification kit 50 prep , genomic dna purification kit 100 prep , revertaid h minus first strand cdna synthesis kit , top vision agarose 100 gm , proteinase k recombinant pcr grade 1 ml , water nuclease fre

Due Date : Jul 17, 2025
Tender Value : rupee 5.39 Lakhs
View Notice
9

Government Departments - Mumbai Suburban - Maharashtra

49860786 bids are invited for addgene lenticrispr v2 - addgene lenticrispr v2 plasmid52961 as bacterial stab , addgene lenticas9 blast - addgene lenticas9 blast plasmid 52962 as bacterial stab , addgene lentiguide puro - addgene lentiguide puro plasmid 52963

Due Date : Jul 17, 2025
Tender Value : Ref. Document
View Notice
10

Government Departments - Mumbai - Maharashtra

49853070 bids are invited for t4 dna ligase 500 units cat no 15224 025 a , ia019 10 alkaline stabilized recombinant protein a , t4 dna ligase 500 units cat no 15224 025 b , t4 dna ligase 500 units cat no 15224 025 c , t4 dna ligase 500 units cat no 15224 025

Due Date : Jul 18, 2025
Tender Value : Ref. Document
View Notice
11

Government Departments - Khordha - Odisha

49829176 bids are invited for nucleospin plasmid 250 rxn1 - nucleospin plasmid 250 rxn 1 , tb green advantage qpcr premix 200 rxns , advantage 2 pcr kit 100 rxns , solid baffle for larvae for 1l 5ml , breeding tank , nucleospin gel and pcr clean up 250 rxn 1

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
12

Government Departments - Sheikhpura - Bihar

49815468 tender for rate contract and supply of medical devices/consumables for different healthcare facilities of state of bihar

Due Date : Jul 16, 2025
Tender Value : Ref. Document
View Notice
13

Government Departments - Bhopal - Madhya Pradesh

49808760 tender for supply of dna kits item for lab of mp - extraction kit for hid nimbus presto automated dna extraction system (routine forensic sample) dna extraction kit for hid nimbus presto automated dna extraction system (difficult forensic sample) kits f

Due Date : Jul 7, 2025
Tender Value : Ref. Document
View Notice
14

Government Departments - Bengaluru Urban - Karnataka

49741519 bids are invited for , viral rna extraction kit viral rna extraction kits total quantity : 1

Due Date : Jul 10, 2025
Tender Value : Ref. Document
View Notice
15

Government Departments - Mumbai Suburban - Maharashtra

49732068 bids are invited for supply of recombinant plasmids with codon optimised custom gene( , custom gene( total quantity : 8

Due Date : Jul 11, 2025
Tender Value : Ref. Document
View Notice
16

Government Departments - Jamnagar - Gujarat

49693612 bids are invited for automated rna extraction kit qiaamp dsp pathogen mini , forensic dna extraction kit total quantity : 2432

Due Date : Jul 8, 2025
Tender Value : Ref. Document
View Notice
17

Government Departments - lucknow - Uttar Pradesh

49623629 Corrigendum : tender for supply of viral rna extraction kit

Due Date : Jul 9, 2025
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail