Laboratory Equipments Tenders from India

1258 Laboratory Equipments tenders are published by various Tendering Authorities & Private companies. 1258 live Tender for Laboratory Equipments are available in Laboratory Equipments Tender section You can further filter Laboratory Equipments tenders by Tender Value, Tender Submission Date or Project Location.

Search Result

Cooperative - thrissur - Kerala

50031802 tender for supply installation testing and commissioning of 1 no 10klph homogenizer at thrissur dairy under annual plan 2024 25 govt of kerala

Due Date : Jul 25, 2025

Tender Value :

60 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Chandigarh - Chandigarh

50031719 bids are invited for calibration services - mechanical, electrical; vibration electrodynamics stand; nabl labs; buyer premises (onsite)

Due Date : Jul 19, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Bhopal - Madhya Pradesh

50031189 bids are invited for calibration services - electrical; voltage, current, power (ac/dc), frequency, power factor, phase angle, resistance; nabl labs; lab

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bengaluru Urban - Karnataka

50030509 bids are invited for customized amc/cmc for pre-owned products - truenat autoprep plus quadro; molbio; annual maintenance contract (amc); quarterly; no

Due Date : Jul 14, 2025

Tender Value :

1 Lakhs

View Notice

Boards / Undertakings / PSU - Chittorgarh - Rajasthan

50030120 bids are invited for customized amc/cmc for pre-owned products - semi- automatic tld badge reader system; nucleonix system pvt ltd; annual maintenance contract (amc); quarterly; no

Due Date : Jul 25, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Hyderabad - Telangana

50029898 bids are invited for customized annual maintenance contract / comprehensive maintenance contract for pre-owned products - clean lab 10000 and class 100 laminar flow benches; indigenized; annual maintenance contract (amc); quarterly; no

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - guwahati - Assam

50029799 tender for supply of different types of filter papers

Due Date : Jul 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Lucknow - Uttar Pradesh

50029628 bids are invited for design installation and maintenance of educational lab - vocational lab; as per rfp; buyer

Due Date : Jul 24, 2025

Tender Value :

9 Crore

View Notice

Statutory Bodies & Commissions/Committees - CHENGALPATTU - Tamil Nadu

50029613 tender for performing onsite/offsite calibration of laboratory equipments at hbl, integrated vaccines complex, chengalpattu

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Panchkula - Haryana

50028915 tender for purchase of 126 no lab refrigerators and 163 no air conditioner

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Sikar - Rajasthan

50027957 construction of mortuary in sdh hospital reengus district sikar

Due Date : Jul 19, 2025

Tender Value :

9.80 Lakhs

View Notice

Government Departments - Lucknow - Uttar Pradesh

50027626 bids are invited for 1 tune solution (thermo-4arev-500ml) 2 quartz torch 3 injector 2.5 mm id quartz 4 sample cone 5 skimmer icap q/qnova ni for insert 6 peristaltic pump tubing 100,508 mm or/ye total quantity : 8

Due Date : Jul 25, 2025

Tender Value :

5.87 Lakhs

View Notice

Boards / Undertakings / PSU - PONDICHERRY - Puducherry

50027444 supply of consumables,

Due Date : Jul 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Baran - Rajasthan

50025866 tender for accusure cbc machine 5 part regent purchase

Due Date : Jul 18, 2025

Tender Value :

9.90 Lakhs

View Notice

Government Departments - Jaisalmer - Rajasthan

50025372 tender for supply of laboratory drying oven.

Due Date : Jul 15, 2025

Tender Value :

3 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

50025034 bids are invited for customized amc/cmc for pre-owned products - refrigerated centrifuge- model -wt-70 bl; refrigerated centrifuge- model -wt-70 bl; annual maintenance contract (amc); quarterly; no

Due Date : Jul 19, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kolkata - West Bengal

50024982 tender for supply of the under mentioned goods or article

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Pune - Maharashtra

50024925 tender for shifting and re installation of fume hoods in the chemistry lab 1sl floor lab no. c217a research lab at user pune.

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - palampur - Himachal Pradesh

50024494 tender for supply, installation, testing and commissioning of medium term storage (mts) chambers for germplasmin csk hpkv palampur

Due Date : Jul 22, 2025

Tender Value :

90 Lakhs

View Notice

Boards / Undertakings / PSU - Jodhpur - Rajasthan

50023956 tender for supply of goods/services like electrical & plumbing materials, laboratory materials, hair cutting work of students, cctv amc work, cctv materials & cameras, bread & bakery materials, tuckshop (mobile canteen), bus hire, tent hire etc.

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Patan - Gujarat

50023653 bids are invited for calibration services - medical; medical device calibration; nabl labs; buyer premises (onsite)

Due Date : Jul 14, 2025

Tender Value :

6 Lakhs

View Notice

Government Departments - sarni - Madhya Pradesh

50023325 tender for onsite calibration of lab instruments nabl accredited imd 4 at stps sarni.

Due Date : Jul 17, 2025

Tender Value :

53300.0

View Notice

Government Departments - sarni - Madhya Pradesh

50023323 tender for calibration of chemical laboratory instruments equipment at 2x250mw stps sarni

Due Date : Jul 18, 2025

Tender Value :

11771.0

View Notice

Government Departments - Pune - Maharashtra

50022599 tender for sys,ot,regenerative_thermal_oxidizer

Due Date : Jul 22, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Shillong - Meghalaya

50022204 tender for blood agar base 500g , brain heart infusion broth 500g , mueller hinton agar 500g , mac conkey agar 500g , cled agar 500g , tryptic soy broth 500gm , edta 500gm , phosphate buffer saline , microtitre plate flat bottom , phenol chloroform 5

Due Date : Jul 23, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Cachar - Assam

50022202 bids are invited for zok-27 pig lead (v2) as per is 27, vacuum oven, diesel generator set as per jss 6115-27-2022, reciprocal shakers - mechanical shaker machine with timer, barium chloride liquid, auramine o for microscopy, portable x - ray machine

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Rohtak - Haryana

50022197 bids are invited for medical centrifuge total quantity : 6

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Gaya - Bihar

50022133 bids are invited for sperm preparation media for iui htf pack 10x1 ml 40 percent 10x1 ml 80 percent 10x5mlhtf,sperm prep total quantity : 38386

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - sikkim - Sikkim

50022093 bids are invited for cleantech total quantity : 1

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mysore - Karnataka

50022018 bids are invited for hypobaric cum normobaric hypoxia chamber total quantity : 1

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Solan - Himachal Pradesh

50022016 bids are invited for vertical laminar air flow , laminar air flow cabinets or stations total quantity : 2

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Kozhikode - Kerala

50021806 bids are invited for rcpt apparatus , moulds for use in tests of cement, concrete and pozzolana conforming to is 10086 total quantity : 1

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Guna - Madhya Pradesh

50021798 bids are invited for hydrogen metering system(coriolis) , metering pumps total quantity : 1

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

50021776 bids are invited for surface plasma treatment piezo brush pz3 , reciprocal shakers - mechanical shaker machine with total quantity : 1

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhopal - Madhya Pradesh

50021774 bids are invited for norovirus ii forward primer , norovirus ii reverse primer , norovirus ii probe , norovirus ii.i forward primer , norovirus ii.i reverse primer , norovirus ii.i probe , norovirus ii.2 forward primer , norovirus ii.2 reverse primer

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Visakhapatnam - Andhra Pradesh

50021766 bids are invited for 10 l borosilicate glass laboratory beaker , 5 l borosilicate glass laboratory beaker , 2 l borosilicate glass laboratory beaker , 25 ml borosilicate graduated cylinder , 50 ml borosilicate graduated cylinder , 250 ml borosilicate

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Raigad - Maharashtra

50021759 bids are invited for shaker incubator , laboratory incubators total quantity : 2

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Lucknow - Uttar Pradesh

50021757 bids are invited for shower bathing trolley , water baths total quantity : 1

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Darjeeling - West Bengal

50021732 bids are invited for triglycerides system pack - triglycerides system pack for bonavera chem 200 , creatinine system pack - creatinine system pack for bonavera chem 200 , sgpt system pack - sgpt system pack for bonavera chem 200 , bilirubin system pa

Due Date : Jul 29, 2025

Tender Value :

9.97 Lakhs

View Notice

Government Departments - Barmer - Rajasthan

50021027 tender for supply of lab material

Due Date : Jul 10, 2025

Tender Value :

50000.0

View Notice

Government Departments - Amritsar - Punjab

50020971 tender for supply of machinery equipment

Due Date : Jul 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - guwahati - Assam

50020917 tender for supply of filter papers to the central laboratory, assam pollution control board

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - ranchi - Jharkhand

50020866 tender for open e tender is being invited for rate contract for library preparation kit and consumables for covid-19 genome sequencing for the department of genetics and genomics, at rims, ranchi, valid for two years

Due Date : Aug 5, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Barmer - Rajasthan

50020825 tender for supply of lab item

Due Date : Jul 11, 2025

Tender Value :

50000.0

View Notice

Government Departments - Thiruvallur - Tamil Nadu

50020768 bids are invited for calibration services - calibration of spcs gdc and ldv pems equipment in powertrain lab garc; calibration of spcs gdc and ldv pems equipment in powertrain lab garc; horiba; user defined

Due Date : Jul 16, 2025

Tender Value :

46.07 Lakhs

View Notice

Government Departments - Bengaluru Urban - Karnataka

50020712 bids are invited for calibration services - thermal, as per technical specifications; temperature, as per technical specifications; nabl labs; buyer premises (onsite)

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - lucknow - Uttar Pradesh

50020624 tender for laboratory chemicals, bio-chemicals, oligos, plasticware, glassware, filter paper etc. for use in csir-nbri => limited

Due Date : Jul 23, 2025

Tender Value : Ref. Document

View Notice

Government Departments - manapparai - Tamil Nadu

50020458 tender for obtaining approval from directorate of town and country planning (dtcp) for tissue machine building and other factory buildings at tnpl unit ii

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

50020308 bids are invited for custom bid for services - upscaling of nanocurcumin formulation under gmp and its bioequivalence and biodistribution studies

Due Date : Jul 25, 2025

Tender Value :

2.22 Crore

View Notice

Boards / Undertakings / PSU - hyderabad - Telangana

50020301 tender for supply and installation of blood centre equipment in our red cross blood center, vidyanagar, hyderabad

Due Date : Jul 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Baran - Rajasthan

50019966 tender for turnkey solution for electrical circuit design lab

Due Date : Jul 14, 2025

Tender Value :

7.85 Lakhs

View Notice

Boards / Undertakings / PSU - ranchi - Jharkhand

50019597 tender for expression of interest for empanelment of nabl accredited testing laboratories for environmental baseline data generation.

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - SHAKTINAGAR - Karnataka

50018229 tender for periodical maintenance & overhauling of condensers, bfps, hp heaters, aprds, deaerator, centrifuge units of turbine and auxiliaries of units 5, 6, 7 & 8 pmoh-2.

Due Date : Jul 21, 2025

Tender Value :

1.12 Crore

View Notice

Government Departments - Ajmer - Rajasthan

50015874 supply of alkaline phos.erba system pack, per pack [alkaline phos.erba system pack, per pack of (2x44ml/2x11ml)]

Due Date : Jul 11, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mumbai - Maharashtra

50015771 corrigendum : supply of capillary sampling point

Due Date : Jul 12, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Rajauri - Jammu And Kashmir

50011230 bids are invited for refrigerator with stabilizer , laboratory refrigerator (v2) total quantity : 1

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Leh - Ladakh

50010924 bids are invited for blood lancets (q2) mse yes | partial | experience - 1 year (s) total quantity : 1000

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Leh - Ladakh

50010923 bids are invited for urine collection bag (v2) (q2) mse yes | partial | experience - 1 year (s) total quantity : 300

Due Date : Jul 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kapurthala - Punjab

50010635 bids are invited for urine test strip (q2) mse total quantity : 7000

Due Date : Jul 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Nagpur - Maharashtra

50010539 bids are invited for quantitative filter paper grade whatman-40 or equivalent (packet of 100 circles each 125 mm diameter , quantitative filter paper grade whatman-42 or equivalent (packet of 100 circles each 125 mm diameter , quantitative filter pap

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Lucknow - Uttar Pradesh

50010482 bids are invited for forensic dna lab works , human identification- dna: x choromosonal str (forensic use) total quantity : 1

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Chandigarh - Chandigarh

50010345 bids are invited for tapestation (bioanalyzer) , horizontal electrophoresis system total quantity : 1

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Khordha - Odisha

50010266 bids are invited for gel documentation system (q2) total quantity : 1

Due Date : Jul 21, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Lucknow - Uttar Pradesh

50010259 bids are invited for programmable oil bath calibration system , reversion oil bath total quantity : 4

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Vadodara - Gujarat

50010237 bids are invited for vr based lab for weapon tech , virtual reality (vr) classroom set up total quantity : 1

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Vadodara - Gujarat

50010207 bids are invited for est of hyd trg lab with integrated facility for hyd system , environmental chamber total quantity : 1

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Bhopal - Madhya Pradesh

50010154 bids are invited for gel card centrifuge (q3) , gel card incubator (q3) (( 3 3 20 lakh (s) )) total quantity : 2

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jaisalmer - Rajasthan

50010101 bids are invited for laboratory drying oven (q3) total quantity : 12

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Lucknow - Uttar Pradesh

50010078 bids are invited for individually ventilated cage system (ivcs) (q3) total quantity : 2

Due Date : Jul 26, 2025

Tender Value :

34 Lakhs

View Notice

Government Departments - 24 Paraganas South - West Bengal

50010050 bids are invited for real time pcr kits (v2) (q2) mse total quantity : 300

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - 24 Paraganas South - West Bengal

50010049 bids are invited for real time pcr kits (v2) (q2) mse total quantity : 100

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Thiruvananthapuram - Kerala

50010025 bids are invited for human identification - dna kit autosomal str (forensic use) (q3) total quantity : 40

Due Date : Jul 15, 2025

Tender Value :

32 Lakhs

View Notice

Government Departments - Nagpur - Maharashtra

50009958 bids are invited for pds filter paper , cellulose nitrate filter paper (v2) total quantity : 10

Due Date : Jul 26, 2025

Tender Value :

2.49 Lakhs

View Notice

Government Departments - Delhi - Delhi

50009878 bids are invited for cell pack dcl - 20 ltr , sulfolyser - 5 ltr , lyscercell wnr - 5 ltr , lysercell wdf - 5 ltr , flurocell wdf - 42 ml x2 , flurocell ret - 12 ml x2 , flurocell wnr - 82 mlx 2 , flurocell plt - 12 mlx2 , cell clean - 50 ml , xn che

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chennai - Tamil Nadu

50009782 bids are invited for centrifuge spares - rubber metal bush , a - grooved ball bearing , b - grooved ball bearing0011 6012 680x12 , c - clutch shoe , d - gasket , e - gasket , f - gasket , g - gasket , h - gasket , i - gasket , j - gasket total quanti

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - pune - Maharashtra

50009347 tender for purchase of equipment for creation of digital lab for yashada pune

Due Date : Jul 18, 2025

Tender Value :

44 Lakhs

View Notice

Government Departments - gandhinagar - Gujarat

50009285 tender for supply of chemicals, reagents, glass wares, metal wares, plastic wares, safety items, filter papers and refilling of gases having nature of consumables.

Due Date : Jul 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - noida - Uttar Pradesh

50008504 tender for single tender enquiry for lab misc. item; repeater dispenser cat. no. t-1000.

Due Date : Jul 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Raipur - Chhattisgarh

50008502 tender for consumable items for ug lab of biochemistry department at ai ims raipur.

Due Date : Jul 9, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Raipur - Chhattisgarh

50008478 tender for procurement of consumables for vrdl project of aiims raipur.

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Bengaluru Urban - Karnataka

50007839 tender for supply installation testing and commissioning of electrodynamic shaker

Due Date : Jul 28, 2025

Tender Value :

35 Lakhs

View Notice

Government Departments - Ghaziabad - Uttar Pradesh

50007617 bids are invited for demonstration eye piece,double demonstration eye piece,stage incubator,centrifuge high speed with t total quantity : 65

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Lucknow - Uttar Pradesh

50007558 bids are invited for tune solution - tune solution (thermo-4arev-500ml) , quartz torch , injector - injector 2.5 mm id quartz , sample cone , skimmer icap - skimmer icap q/qnova ni for insert , peristaltic pump tubing - peristaltic pump tubing 100,50

Due Date : Jul 26, 2025

Tender Value :

5.87 Lakhs

View Notice

Government Departments - Delhi - Delhi

50007488 bids are invited for megascript t7 transcription kit , dynabeads tmmyon tmstreptavidin c1 , bio 16 utp , pierce tm3x dykddddk peptide , anti flagm2 magnetic beads , rnaseou tmrecombinant ribonuclease inhibitor , quantinova sybr green pcr kit , plasmi

Due Date : Jul 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Pondicherry - Puducherry

50007464 bids are invited for hot air oven (prosthetics oven) , hot air oven (fssai) total quantity : 1

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Ghaziabad - Uttar Pradesh

50007462 bids are invited for microtome sledge large cutting,articulated skelton set real human bones,disarticulated bone sets,we total quantity : 149

Due Date : Jul 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Jodhpur - Rajasthan

50007408 bids are invited for guelph permeameter kit , isolation equipment total quantity : 1

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Thanjavur - Tamil Nadu

50007264 bids are invited for technical documentation , gel documentation system document folder total quantity : 300

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Singrauli - Madhya Pradesh

50007172 bids are invited for pr_100252326_m2679140523_filter paper _item-10_schedule-1 - filter paper , pr_100252326_m2679140522_filter paper _item-20_schedule-2 - filter paper , pr_100252326_m2679140411_filter paper _item-30_schedule-3 - filter paper , pr_1

Due Date : Jul 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Delhi - Delhi

50007164 bids are invited for 1 primers - forward cccctagatgggggaacaga20bp , 2 primers - reversegcattgttctcgggtgcaag 20bp , 3 primers - forward aggcagatggacctggatttga22bp , 4 primers - reversetggcttgcaaatagactcatctcc 24bp , 5 primers - forward gcctggcacatagta

Due Date : Jul 26, 2025

Tender Value :

38 Lakhs

View Notice

Boards / Undertakings / PSU - Panchkula - Haryana

50006459 tender for procurement of material to support science and math activities for classes 9th to 12th (secondary level) in 3145 govt. schools of the state.

Due Date : Jul 25, 2025

Tender Value :

2.51 Crore

View Notice

Boards / Undertakings / PSU - Panchkula - Haryana

50006436 tender for procurement of material to support science and math activities for classes 6th to 8th (elementary level) in 5365 govt. schools of the state.

Due Date : Jul 25, 2025

Tender Value :

2.68 Crore

View Notice

Government Departments - Chittorgarh - Rajasthan

50005673 tender for supply of lab regents & xray

Due Date : Jul 12, 2025

Tender Value :

3 Lakhs

View Notice

Cooperative - karnal - Haryana

50005523 tender for supply of cf machine

Due Date : Jul 17, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Dholpur - Rajasthan

50005374 tender for materials /laboratory regents item required to conduct the lab in chc sarmathura distt dholpur - disposible test tubo glass wares cover slips per box (20 pkt) distilled water 20 ltr. glass wares e.s.r. pipette disp. with vaccum plug plastic

Due Date : Jul 11, 2025

Tender Value :

9 Lakhs

View Notice

Boards / Undertakings / PSU - Bhubaneswar - Odisha

50005260 tender for supply and installation of the following items

Due Date : Jul 10, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Visakhapatanam - Andhra Pradesh

50004956 tender for supply, installation, testing and commissioning of high volume air sampler and portable air sampler at project site in nd(v)

Due Date : Aug 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Alwar - Rajasthan

50004936 tender for chemical, instrument, filter paper purchase - potassium dichromate (ar) ferrous ammonium sulphate (ar) sodium bicarbonate (ar) ammonium molybdate (ar) ammonium acetate (ar) mono calcium phosphate (ar) barium chloride (ar) tea (ar) sulph

Due Date : Jul 11, 2025

Tender Value :

5 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

50004618 bids are invited for blood lancets (q2) mse total quantity : 5000

Due Date : Jul 26, 2025

Tender Value : Ref. Document

View Notice

100

Boards / Undertakings / PSU - Bhubaneswar - Odisha

50003765 tender for providing whole genome sequencing of 5 seaweed varieties (long read sequencing with analysis)

Due Date : Jul 7, 2025

Tender Value : Ref. Document

View Notice

Top