39 Aluminium Foil tenders in Meghalaya 2024

Get latest Aluminium Foil related Tenders, online published by Government Of Meghalaya, Meghalaya Administrative Training Institute, Meghalaya Basin Management Agency from Meghalaya state. Participate online through e-Procurement website for Aluminium Foil tenders in Meghalaya. Download Tender Documents, BOQ, Technical Bids for Aluminium Foil related Tenders from Meghalaya. Get Bidding support for etenders related to Aluminium Foil Tenders in Meghalaya. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Aluminium Foil tenders published from Meghalaya. Also get daily email alerts for Aluminium Foil related tender notices published by Government of Meghalaya.

1

Local Bodies - East Khasi Hills - Meghalaya

44546609 bids are invited for list of chemicals centrifuge tube, 0.5ml , spinwin micro centrifuge tube, 1.5ml , tip universal beveled grad bulk,1000ul , centrifuge tube conical bottom,50ml , plastic micro pestle , polypropylene powder funnel, 1000mm , bluple nitrile gloves, small , culture petridish, 150x20mm , tissue paper roll , aluminium foil , rnase kit , blupe nitrile gloves small , ethanol 500ml , molecular grade water , d mannitol , microtips 0.2 10ul , ribofalvin , 0.2m sodium phosphate buffer p...

Due Date : Aug 24, 2024
Tender Value : Ref. Document
View Notice
2

Local Bodies - East Khasi Hills - Meghalaya

42255138 bids are invited for list of consumables loading dye 6x1ml , tris base , agarose , 2 propanol , anthrone , glucose , tris buffer , adp , edta , nadh , perchloric acid , sodium hydroxide pellets , ketoglutarate , rna xpress reagent , urea , hcl , sulphuric acid , manganese ii sulphate , diacetyl monoxime , ctab , manganese ii chloride , sodium glycinate , l arginine , ammonium persulphate , temed , potassium hydroxide , diphenylamine , orcein , hiclean , dpx mountant , parafin wax noncaking , mi...

Due Date : Mar 1, 2024
Tender Value : Ref. Document
View Notice
3

Government Departments - East Khasi Hills - Meghalaya

41060413 Corrigendum : bids are invited for ncdc project microbiology absolute alcohol 500 ml , amikacin 30ug , amoxycillin clavulanate 20 10ug , ampicillin 10ug , ampicillin sulbactum 10 10ug , autoclavable storage vial 10ml , azithromycin 15mcg , aztreonam 30ug , bunsen burner , cefixime 30 mcg , cefotaxime 30ug , cefoxitin 30ug , ceftazidime 30ug , ceftriaxone 30ug , chloramphenicol 30ug , ciprofloxacin 5ug , clindamycin 2mcg , colistin sulfate powder 5g vial , co trimoxazole 1.25 by 23.75 mcg , cotton roll 500gm ...

Due Date : Feb 9, 2024
Tender Value : rupee 5 Lakhs
View Notice
4

Government Departments - East Khasi Hills - Meghalaya

40418175 bids are invited for meliodosis project petriplates 90mm 90x14mm triple vent and sterile , test tube stand 16mm tube diameter 31 places , metaloo ss 4 4mm diameter fixed nichrome loop embedded in ss with heat resistant handle. , minus 20 degree c mini cooler 12 places pc non toxic gel 1.8ml , 0 degree c mini cooler 12 places pc non toxic gel 1.8ml , soft loop sterile 1microlitre material ps 1 microlitre pouch of 10 , soft loop sterile 10 microlotre material ps 10 microlitr...

Due Date : Nov 9, 2023
Tender Value : rupee 5 Lakhs
View Notice
5

Government Departments - East Khasi Hills - Meghalaya

40254344 bids are invited for detection of melioidosis microbiology dept 1 24 petriplates 90mm 90x14mm triple vent and sterile , test tube stand 16mm tube diameter 31 places , metaloo ss 4 4mm diameter fixed nichrome loop embedded in ss with heat resistant handle. , minus 20 degree c mini cooler 12 places pc non toxic gel 1.8ml , 0 degree c mini cooler 12 places pc non toxic gel 1.8ml , soft loop sterile 1microlitre material ps 1 microlitre pouch of 10 , soft loop sterile 10 microlotre material ps 10 mi...

Due Date : Nov 2, 2023
Tender Value : rupee 5 Lakhs
View Notice
6

Government Departments - RI BHOi - Meghalaya

38936517 bids are invited for as per boq btc cable 2 core ( 4 sq.mm: 2, 6 sq.mm: 2 ) copper wire ( 4 sq.mm: 2, 1.5 sq.mm: 2, 2.5 sq.mm ) casing pipe ( 25 mm: 20, 35 mm: 20 ) 16 amp ( socket:30. switch: 30, s.s.combined board with indicator fuse: 30 ) 6 amp ( switch: 100, socket: 50 nos ) indicator flash type pvc board ( 10 x 8: 20, 8 x 6: 20, 7 x 4: 20, 4 x 4: 20 ) holder ( angle:100, batten:100, pendent: 100 ) mica sheet ( 10 x...

Due Date : Aug 11, 2023
Tender Value : rupee 8.60 Lakhs
View Notice
7

Boards / Undertakings / PSU - West Garo Hills - Meghalaya

37924151 supply of food packaging equipments food packaging equipments , automatic form fill packing machine: packaging type pillow type; packaging range 50 200 g; packaging size w 100 500 mm l 100 360 mm; packaging speed 10 15 pkt / min; sealing width 3 – 10 mm; working air pressure 6 – 7 kg / cm2, automatic packaging machine with gas flushing is suitable for irregular shaped products like chips. all operations from weighing, filling, gas flushing and sealing are accurately controlled by s...

Due Date : Jun 23, 2023
Tender Value : rupee 14 Lakhs
View Notice
8

Government Departments - ri Bhoi - Meghalaya

37849262 bids are invited for custom bid for services 1 plastic milk pouches of capacity 500 ml with custom printing 2, 00, 000 nos. 2 weighing machine 2 nos. 3 scissors ( large size ) 2 nos. 4 cling roll ( cling wrap ) 5 nos. 5 stainless steel knives ( small size ) 5 nos. 6 pickle pouch ( 100g ) 500 nos. 7 white board marker pen 1 set 8 face mask 2 packets 9 gloves 10 boxes 10 doormat 3 nos. 11 vim liquid 10 nos. 12 harpic 3 nos. 13 colin 5 nos. 14 broom 2 nos. 15 table clea...

Due Date : Jun 5, 2023
Tender Value : rupee 5 Lakhs
View Notice
9

Government Departments - East Khasi Hills - Meghalaya

36807056 Corrigendum : bids are invited for pg microbiology 3 stand vertical horizontal 4 to 5 pipettes , rubber bulb big , rubber bulb small , rubber teat long sizes , slide tray 20 slides capacity , sprit lamp glass metal , silver aluminium foil , sterile swab sticks , thermometer 37degree c , universal wash reagents 500ml , vibrio cholerae 01 3ml , vibrio cholerae 0139 3ml , vibrio cholerae ogawa 3ml , vibrio cholerae inaba 3ml , salmonella polyvalent o 3ml , salmonella polyvalent h 3ml , salmonella polyvalent o2 ...

Due Date : May 17, 2023
Tender Value : rupee 5 Lakhs
View Notice
10

Government Departments - East Khasi Hills - Meghalaya

34658859 Corrigendum : bids are invited for sle project gloves size six point five , sample storage box , eppondorf tubes 2 ml , edta vials 2ml , plain vials 4ml , aluminium foil , parafilm , microtips 10 microlitre , microtips 100 microlitre , microtips 1 ml , tissue roll , agarose 500g , 0 point 01m pbs 1l , 1x tae buffer 1l , human ficolin 1 elisa kit , human ficolin 2 elisa kit , human ficolin 3 elisa kit , human mbl elisa kit , human pentraxin elisa kit , anti cardiolipin igg elisa kit , anti cardiolipin igm eli...

Due Date : Nov 21, 2022
Tender Value : rupee 5 Lakhs
View Notice
11

Government Departments - shillong - Meghalaya

34132586 niet for cassette air conditioners at iim shillong supply of ac, accessories & installation works 2 supply, installation, testing & commissioning ( sitc ) of cassette air conditioners ( approved make only ) having energy efficient twin rotary or scroll compressors, condenser and evaporator coil efficient heat exchanger, aesthetically finished indoor units, automatic temperature & flow control, including supply & filling of required quantity of eco friendly refrigerant ( prefera...

Due Date : Oct 10, 2022
Tender Value : rupee 21.93 Lakhs
View Notice
12

Government Departments - East Khasi Hills - Meghalaya

33849884 Corrigendum : bids are invited for anti h , anti ahg igg and c3d , macconkey purple broth broth for water testing , brilliant green lactose bile broth , trypticase soy agar , test tube brush , centrifuge tubes , aluminium foil roll , micropipette tips , methanol hplc grade, water hplc grade , paraffin solution light total quantity : 424

Due Date : Oct 26, 2022
Tender Value : Ref. Document
View Notice
13

Government Departments - East Khasi Hills - Meghalaya

33706866 Corrigendum : bids are invited for 1x phosphate buffered saline , graduated centrifuge tube 15 ml , 2x pcr master mix , agarose powder low eeo molecular biology grade , ethidium bromide etbr , primers 2 sets oligonucleotide primers desalted. first set my09 5 cgt ccm arr gga wac tga tc 3 and my11 5 gcm cag ggw cat aay aat gg 3 , primers 2 sets oligonucleotide primers desalted. second set gp5 plus 5 tttgttactgtggtagatacta 3 and gp6 plus 5 gaaaaataaactgtaaatcata 3 , nuclease free water pcr grade water. molecula...

Due Date : Sep 12, 2022
Tender Value : rupee 5.05 Lakhs
View Notice
14

Boards / Undertakings / PSU - shillong - Meghalaya

33433725 supply of dab substrate kit peroxidase with nickel , absolute alcohol , cotton , tissue paper , aluminum foil , vectastain elite abc , peroxidase kits , standard .

Due Date : Aug 25, 2022
Tender Value : Ref. Document
View Notice
15

Statutory Bodies & Commissions/Committees - East Khasi hills - Meghalaya

30856241 Corrigendum : bids are invited for urine culture bottle sterile , urine glucose ketone strip ( ketostix ) , vdrl ( rpr ) ( 100 x 1 ) , widal test kit , kit for vdrl rapid method ( 1x50 ) , rapid itc for typhoid ( igm ) , rapid itc for scrub typhus ( igm ) , rapid itc for leptospira , paracheck ( pv / pf ) ( antigen ) , platelet diluting fluid , rafactor test kit , rbc diluting fluid , elisa reader, thermalpaper for , paper, filter, round ( greens no. 795 ) 9 cm, pkt of100 , a...

Due Date : Feb 10, 2022
Tender Value : rupee 5 Lakhs
View Notice
16

Statutory Bodies & Commissions/Committees - Meghalaya

30155562 bids are invited for alcohol methyl alcohol methyl , blood agar base (infusion agar) blood agar base (infusion agar) , brain heart infusion broth with paba & agar brain heart infusion broth with paba & agar , cled agar (with thymol blue) cled agar (with thymol blue) , cyanmethohaemoglobin standard for haemoglobin estimation ampules of 10ml. cyanmethohaemoglobin standard for haemoglobin estimation ampules of 10ml. , aluminium foils. aluminium foils. , prothrombin time reagents to giv...

Due Date : Dec 8, 2021
Tender Value : rupee 45000.0
View Notice
17

Statutory Bodies & Commissions/Committees - east khasi hills - Meghalaya

30145995 bids are invited for alcohol methyl alcohol methyl , blood agar base (infusion agar) blood agar base (infusion agar) , brain heart infusion broth with paba & agar brain heart infusion broth with paba & agar , cled agar (with thymol blue) cled agar (with thymol blue) , cyanmethohaemoglobin standard for haemoglobin estimation ampules of 10ml. cyanmethohaemoglobin standard for haemoglobin estimation ampules of 10ml. , aluminium foils. aluminium foils. , prothrombin time reagents to giv...

Due Date : Dec 7, 2021
Tender Value : Ref. Document
View Notice
18

Statutory Bodies & Commissions/Committees - east khasi hills - Meghalaya

30062975 bids are invited for alcohol methyl alcohol methyl , blood agar base (infusion agar) blood agar base (infusion agar) , brain heart infusion broth with paba & agar brain heart infusion broth with paba & agar , cled agar (with thymol blue) cled agar (with thymol blue) , cyanmethohaemoglobin standard for haemoglobin estimation ampules of 10ml. cyanmethohaemoglobin standard for haemoglobin estimation ampules of 10ml. , aluminium foils. aluminium foils. , prothrombin time reagents to giv...

Due Date : Dec 7, 2021
Tender Value : rupee 50000.0
View Notice
19

Statutory Bodies & Commissions/Committees - MH Shillong - Meghalaya

26175570 purchase of drugs and consumables for mh shillong , alcohol methyl , aluminium foils . , ana kit , aso , automated pippette 200 1000 ul , automated pippette 5 100 ul , bact / alert fa aerobic bott 30 ml , bact / alert fa anerobic bott 30 ml , blood collection bag with cpda anticoagulant 4 ml for collection of 350 ml of blood , bovine albumin 20% , buffer distilled water , c reactive protein ( kit for 35 tests ) , c 310 5 lyphocheck assayed chemistry level 1 ( 12x5ml ) for biochemistry l1&l2 ...

Due Date : Dec 12, 2020
Tender Value : Ref. Document
View Notice
20

Statutory Bodies & Commissions/Committees - MH SHILLONG - Meghalaya

26137573 procurment of medical stores procurment of medical stores mh shillong , alcohol methyl , aluminium foils . , ana kit , aso , automated pippette 200 1000 ul , automated pippette 5 100 ul , bact/alert fa aerobic bott 30 ml , bact/alert fa anerobic bott 30 ml , blood collection bag with cpda anticoagulant 4 ml for collection of 350 ml of blood , bovine albumin 20% , buffer distilled water , c reactive protein ( kit for 35 tests ) , c 310 5 lyphocheck assayed chemistry level 1 ( 12x5ml ) for b...

Due Date : Dec 12, 2020
Tender Value : Ref. Document
View Notice
21

Statutory Bodies & Commissions/Committees - NEIGRIHMS, Shillong, Meghalaya - Meghalaya

22950129 Corrigendum : open e tender for processing of chemicals, reagents, glassware, instruments, surgicals, contrast, etc for the institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later. 1 ki67 ( mib ) 2 kit for identification of mac a gene for mrsa 3 kligler iron agar 4 koser’s citrate broth 5 kovacs indole reagent 6 krait 7 kukri 8 kupferberg t.v. broth base 9 5% solution of l ...

Due Date : Dec 4, 2020
Tender Value : rupee 30 Lakhs
View Notice
22

Statutory Bodies & Commissions/Committees - NEIGRIHMS, Shillong, Meghalaya - Meghalaya

22947207 Corrigendum : open e tender for processing of chemicals, reagents, glassware, instruments, surgicals, contrast, etc for the institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later. 1 albumin 2 microalbumin 3 gamma glutamyl tranferase 4 ( ?? ggt ) 5 amylase 6 lipase 7 ck 8 ck mb 9 ldh 10 total cholesterol 11 triglyceride 12 hdl 13 ldl 14 calcium ...

Due Date : Dec 4, 2020
Tender Value : rupee 30 Lakhs
View Notice
23

Statutory Bodies & Commissions/Committees - NEIGRIHMS, Shillong, Meghalaya - Meghalaya

22946564 Corrigendum : open e tender for processing of chemicals, reagents, glassware, instruments, surgicals, contrast, etc for the institute, for a period of two years, extendable upto 6 months, or till the finalization of the next tender, whichever is later. 1 abciximab ( reopro ) gp ii b, iiia, black 2 ab neurofilament protein 3 ab synaptophysin 4 abrassive 5 abru precatorius 6 abru seed ( white & red ) 7 absolute alcohol ( ar ) 8 absolute alcohol 90...

Due Date : Dec 4, 2020
Tender Value : rupee 30 Lakhs
View Notice
24

Statutory Bodies & Commissions/Committees - MH SHILLONG - Meghalaya

22584348 procurement of medical stores: 1. niv / 17 hemospot kit stool for occult blood ) pkt of 50 cards 2. 171006 kit for estimation of calcium ( 50 ml ) 3. 171008 kit for estimation of amylase ( 12 x 5 ml ) 4. 171009 kit for estimation of ldh ( 12 x 5ml ) 5. 171042 c reactive protein ( kit for 50 tests ) 6. 171001 kit for triglyceride estimation 7. 171002 kit for ldl cholesterol by direct estimation 8. 171003 kit for estimation of bilirubin 32 9. 171004 kit for estimation of ggt (...

Due Date : Dec 11, 2019
Tender Value : rupee 10 Lakhs
View Notice
25

Statutory Bodies & Commissions/Committees - MH SHILLONG - Meghalaya

22060639 procurement of medical stores medical stores : hemospot kit stool for occult blood ) pkt of 50 cards , kit for estimation of calcium ( 50 ml ) , kit for estimation of amylase ( 12 x 5 ml ) , kit for estimation of ldh ( 12 x 5ml ) , c reactive protein ( kit for 50 tests ) , kit for triglyceride estimation , kit for ldl cholesterol by direct estimation , kit for estimation of bilirubin , kit for estimation of ggt ( gamma gluteryl transaminase ) ( 12 x 5 ml ) , s...

Due Date : Oct 24, 2019
Tender Value : rupee 5 Lakhs
View Notice
26

Boards / Undertakings / PSU - Meghalaya

20315545 supply of laboratory items acetic acid acetic acid solution acetonitrile alpha napthol solution acetocarmine acetone aluminium acetate aluminium chloride aluminuim fluoride aluminium foil aluminium sulphate aluminium metal powder aluminium nitrate ammonia buffer solution ammonium acetate ammonnium bromide ammonium chloride ammonium dichromate ammonium flouride ammonium hydrogen phosphate ammonium iodide aspirin barium acetate barium borate barium bromide barium chloride barium nitrate barium...

Due Date : May 30, 2019
Tender Value : Ref. Document
View Notice
27

Statutory Bodies & Commissions/Committees - MH SHILLONG - Meghalaya

17936544 procurement of medicines 231 tetanus toxoid, purified absorbed rubber capped, vial of 5 ml ( 10 doses ) 232 laryngoscope cell 1.5 v dia 13 mm and length 51 mm for 233 hand gloves, size 7 pair of 234 hand gloves, size 7 1 / 2 pair of 235 gloves operational size 8 pair of 236 syringe dosposable, plastic sterile, 10 ml with needle 237 insulin disposable syringe 1ml 238 suspensory scrotal 239 marking pen 240 micropipettes, tips for 1 200 ul 241 semi auto haematology cell counter l...

Due Date : Nov 3, 2018
Tender Value : rupee 25 Lakhs
View Notice
28

Statutory Bodies & Commissions/Committees - SHILLONG - Meghalaya

17634907 tender for procurement of medicines : 211 vitamin b complex therapeutic tab / cap 212 ethambutol 800mg tab 213 monteleukast 5 mg tab 214 salmeterol 50mcg + fluticasone 250 mcg pulverised for inhalation rotacaps, pack of 30 215 colchicine 0.5mg tab 216 fexofenadine hydrochloride tab 120 mg 217 glucosamine 250mg + chondroitin sulphate 200 mg cap 218 inj methotrexate 15mg, 1 ml 219 serratiopeptidase 5mg tab 220 amoxycillin 500mg +clavulanic acid 125mg tab 221 amoxycillin 875mg...

Due Date : Oct 17, 2018
Tender Value : rupee 30 Lakhs
View Notice
29

Boards / Undertakings / PSU - Shillong - Meghalaya

16214969 supply of equipment, chemicals, glassware, computer, furniture, office stationeries etc. : 88. cotton 89. tissue paper 90. aluminum foil 91. ethanol 92. absolute alcohol 93. methanol 94. abony level meter 95. office stationeries( a4, fs, a3 paper, white chalk, color chalk, jem clip, stapler, stapler pin, paper pin, cello tap, brown tap, ball pen, stamp pad & ink, carbon paper, graph paper, glue, battery ,correcting pen, correcting fluid, paper puncher ,thread, scissor, paper cutter, clot...

Due Date : Jun 10, 2018
Tender Value : Ref. Document
View Notice
30

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

13114200 75.14 wash bottle plastic with delivery nozzle 60ml 75.15 bunsen burner 75.16 bacteriological loop holder with loop (ready to use) 75.17 biological indicator for steam (3m) 75.18 ice box 5 litres 75.19 labels for micro centrifuge tubes white size ½” 75.2 metaloops (changeable nichrome loop embedded in brass rod with heat resistant with 75.21 a. 2 mm diameter nichrome wire 75.22 b. 3 mm diameter nichrome wire 75.23 c. 4 mm diameter nichrome wire 75.24 metaloops (fixed straight nichrome loop emb...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
31

Government Departments - 67.51 V.D.R.L. Slides 75mmx50mmx1.45mm - Meghalaya

13114157 71.44 creatinine powder 71.45 isopropyl alcohol, ar grade 71.46 acetone – ar grade ar grade 71.47 aluminium foil 0.3mm thickness 71.48 ammonium chloride –ar grade, 71.49 ammonium nitrate – ar grade, 71.5 ammonium persulphate – ar grade, 71.51 buffer powder/tablets ph 4 , ph – 7 ,ph – 9 71.52 calcium chloride dihydrade – ar grade, 71.53 dinitro phenyl hydrazine ar grade, 71.54 magnesium chloride – ar grade, 71.55 magnesium sulfate –ar grade, 71.56 methanol – acetone free – hplc grade, 71....

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
32

Government Departments - 67.51 V.D.R.L. Slides 75mmx50mmx1.45mm - Meghalaya

13114143 68.99 gram iodine 69 strip elisa igg anti hdv 69.01 storage box for 1.5ml microfuge tubes 69.02 andrades indicator 69.03 hexamine 69.04 borax 69.05 borax ar, 69.06 silver aluminium foil / wrap paper 69.07 clavualnate 10ug 69.08 calcium chloride 69.09 disodium hydrogen phosphate 69.1 dextrose powder 69.11 edta powder ( k+ ) 69.12 gelatin 69.13 l giutamine 69.14 potassium chloride 69.15 potassuirn di hydrogen phosphate 69.16 sodium hydrogen phosphate monobasic 69.17 saturated glycerol 69.18 su...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
33

Government Departments - Meghalaya

13113957 processing of reagents and consumables: 71.09 rf 71.1 lipoprotein (a) 71.11 lipoprotein (a) calibrator 71.12 transferrin 71.13 cystatin c 71.14 gentamycin 71.15 barbiturates 71.16 valproic acid 71.17 phenitoin 71.18 vma 71.19 galactosemia 71.2 calcitonin 71.21 calcitriol 71.22 galactokinase 71.23 galactose 1 phosphate uridyl transferase 71.24 renin 71.25 acth 71.26 interleukin 1 71.27 interleukin 4 71.28 interleukin10 71.29 leukotrine a4 71.3 leukotrine b4 71.31 leukotrine c4 71.32 leukotri...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
34

Government Departments - Meghalaya

13113950 processing of reagents and consumables: 68.99 gram iodine 69 strip elisa igg anti hdv 69.01 storage box for 1.5ml microfuge tubes 69.02 andrades indicator 69.03 hexamine 69.04 borax 69.05 borax ar, 69.06 silver aluminium foil/wrap paper 69.07 clavualnate 10ug 69.08 calcium chloride 69.09 disodium hydrogen phosphate 69.1 dextrose powder 69.11 edta powder (k+) 69.12 gelatin 69.13 l giutamine 69.14 potassium chloride 69.15 potassuirn di hydrogen phosphate 69.16 sodium hydrogen phosphate monobas...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
35

Government Departments - 69.34 Phenol Red Solution 0.5% - Meghalaya

13113734 71.41 sodium carbonate 71.42 potassium dihydrogen phosphate 71.43 potassium dihydrogen phosphate kh2po4 (hplc grade) 71.44 creatinine powder 71.45 isopropyl alcohol, ar grade 71.46 acetone – ar grade ar grade 71.47 aluminium foil 0.3mm thickness 71.48 ammonium chloride –ar grade, 71.49 ammonium nitrate – ar grade, 71.5 ammonium persulphate – ar grade, 71.51 buffer powder/tablets ph 4 , ph – 7 ,ph – 9 71.52 calcium chloride dihydrade – ar grade, 71.53 dinitro phenyl hydrazine ar grade, 71...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
36

Government Departments - Neigrihms, Mawdiangdiang, Shillong - Meghalaya

13113705 68.64 yeast fermentation broth (m 676) 68.65 yeast nitrogen base agar 68.66 yeast nitrogen base(m139) 68.67 yeast peptone agar 68.68 yellow tips 2 200ul 68.69 yep agar (yeast extract peptone agar) 68.7 yessinia selective agar base (m843) 68.71 yessinia selective supplement (fd 034) 68.72 zinc acetate lr 68.73 zinc granules 68.74 zinc nano powder 68.75 zinc oxide powder 68.76 zinc oxide – ar, 68.77 zinc sulphate 68.78 zinc dust 68.79 zinc dust(rmk 888) 68.8 zn acid fast stain kit 68.81 zn stain ...

Due Date : Aug 17, 2017
Tender Value : rupee 10 Lakhs
View Notice
37

Statutory Bodies & Commissions/Committees - Shillong - Meghalaya

11431277 rate contract for processing of chemicals, reagents, glassware, instruments, surgicals, contrast: 75.22 b. 3 mm diameter nichrome wire 75.23 c. 4 mm diameter nichrome wire 75.24 metaloops (fixed straight nichrome loop embedded in ss rod with heat resistant 75.25 microtome knife 75.26 mops 75.27 magnifying glass, big size with handle 75.28 mortar pestle 75.29 nichrome loop 4 mm 75.3 nichrome loop 2 mm 75.31 nichrome loop 1.3 mm 75.32 pipette stand( vertical & horizontal) 4/5 pipettes...

Due Date : Jan 24, 2017
Tender Value : Ref. Document
View Notice
38

Statutory Bodies & Commissions/Committees - Meghalaya

11407425 processing of chemicals, reagents, glassware, instruments, surgicals, contrast: 48 38.7 acid ascorbic lr 38.71 acid barbituric annual / repair 38.72 acid citric anhydrous lr 38.73 acid fuchsin 38.74 acid fuchsin 38.75 acid fuchsin.ms ( ci 42780 ) . 38.76 acid hydrochloric annual / repair 38.77 acid hydrochloric lr 38.78 acid l tartaric annual / repair 38.79 acid molybdic lr 38.8 acid nitric annual / repair 38.81 acid nitric lr 38.82 acid phosphat...

Due Date : Jan 24, 2017
Tender Value : Ref. Document
View Notice
39

Boards / Undertakings / PSU - Shillong - Meghalaya

10913781 procurement of equipment, chemicals, glassware, computer, furniture, office stationeries etc. 1. cod 2. spectrophotometer 3. microscopes ( simple and polarizing ) 4. laptop core i5 / i7, 8 gb sd ram, 1 / 2 terminal box hdd with preloaded licensed windows 5. stereoscope ( 5x15 ) 6. aerial photographs ( 4 ) stereo pair 5 pairs 7. satellite image ( printed ) 8. desktop computers core i 5 ...

Due Date : Nov 15, 2016
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you

Tenders By City

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail