1123 Hplc tenders in Maharashtra 2025

Get latest Hplc related Tenders, online published by Bank Of Maharashtra, Cidco Maharashtra Ltd., City and Industrial Development Corporation of Maharashtra from Maharashtra state. Participate online through e-Procurement website for Hplc tenders in Maharashtra. Download Tender Documents, BOQ, Technical Bids for Hplc related Tenders from Maharashtra. Get Bidding support for etenders related to Hplc Tenders in Maharashtra. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Hplc tenders published from Maharashtra. Also get daily email alerts for Hplc related tender notices published by Government of Maharashtra.

Search Result

Government Departments - Pune - Maharashtra

47640465 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Feb 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - kharghar - Maharashtra

47632646 tender for design, support, supply, installation and commissioning, training, warranty and amc of medical cyclotron with turnkey

Due Date : Mar 24, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Nagpur - Maharashtra

47609937 bids are invited for boron trifluoride 500 ml , chloroform hplc grade 500 ml , hexane ar grade , petrolium ether , sodium sulfate ar total quantity : 42

Due Date : Feb 27, 2025

Tender Value :

5 Lakhs

View Notice

Government Departments - Mumbai - Maharashtra

47595386 bids are invited for consumables precicontrol clinchem multi 1 roche 5ml , precicontrol clinchem multi 2 roche 5ml , cleaner cobas integra or cobas c111 roche 1000 ml , ise deproteinizer c111 , ambion depc treated water , takara emrald gt pcr master

Due Date : Feb 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

47574902 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Feb 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

47569741 bids are invited for stationary venishing blinds , hplc register 300 pages icmr crmch niih a , hplc register 300 pages icmr crmch niih b , hplc register 300 pages icmr crmch niih d , hplc register 300 pages icmr crmch niih e , hplc register 300 pages

Due Date : Feb 27, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - mumbai - Maharashtra

47544436 tender for annual rate contract for supply of laboratory research chemicals/ glassware / plastic ware / consumables/hp cartridges (product category as per chapter no 2 of this bid document)

Due Date : Feb 24, 2025

Tender Value :

30 Lakhs

View Notice

Government Departments - mumbai - Maharashtra

47504080 tender for supply of laboratory instruments group c , item description (refer tender document for details) , hplc , polari meter , tintometer , water purification system , flame photometer

Due Date : Feb 13, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

47449452 bids are invited for chemicals ethanol ar grade pack of 500 ml , oxone synthesis grade pack of 250 g , dried methanol hplc grade pack of 500 ml , sodium nitrate synthesis grade pack of 500 g , sodium hydroxide synthesis grade pack of 500 g , potassiu

Due Date : Feb 20, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Mumbai - Maharashtra

47425336 Corrigendum : tender for purchase of acetonitrile hplc grade required for therapeutic drug monitoring system

Due Date : Feb 10, 2025

Tender Value :

2.95 Lakhs

View Notice

Government Departments - Mumbai - Maharashtra

47425213 bids are invited for consumables cryo box 100 wells , cryo box 50 wells , transparent micro centrifuges tubes 1 5 ml abdos pack of 1000 no s , amber micro centrifuges tubes 1 5 ml abdos pack of 1000 no s , white blotting paper sheets for general labo

Due Date : Feb 19, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

47415329 bids are invited for hplc column boq 2 10 l8 amino 15 cmx 4 6 mm x 3um , l82 15 cm x 4 6 mm x 5 um , l13 c1 250 cm x 46 x5 um , l61 25 cm x 2 mm , l1 25 cm x 4 6x 5 um , l40 25 cmx 4 6x5um , l7 octylsilane 25 cm x 4 6 3 um aminopropylsilane 15 cmx 4.

Due Date : Feb 18, 2025

Tender Value :

7.10 Lakhs

View Notice

Government Departments - Mumbai - Maharashtra

47414724 bids are invited for consumables geneall column type d , ez 10 dna gel extraction kit , biorad variant ii hplc kits a hsn code 38220090 , hpyf3i ddel 500 units , sigma oligos 5od hplc purified , consumables for digital duplicators total quantity : 10

Due Date : Feb 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

47412059 bids are invited for consumables hplc with pda detector for amino acid profiling , cyt inf d , cyt inf efdb 20 , dfs taq polymerase bioron 500 units , 4you4 dntp mix 10mm each 200ul , taqara ex taq polymerase hot start 250 unit , qiagen multiplex pcr

Due Date : Feb 18, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Thane - Maharashtra

47411795 bids are invited for boq titanium sheet autostainer , liquid based , electrophorosis , hplc , manual rotary microtome , automated rotary microtome , paraffin embbedding bath , heated paraffine embbedding module , automated tissue processor histokinet

Due Date : Feb 17, 2025

Tender Value :

1.66 Crore

View Notice

Government Departments - Mumbai - Maharashtra

47397429 bids are invited for stationary oligonucleotide primers hplc purified , oligonucleotide primers for qpcr hplc purified , applied biosystems powerup sybr green master mix for qpcr 100rxns 1ml , dnase i rnase free , sigma oligos 50d dry desalted , stat

Due Date : Feb 18, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

47365612 bids are invited for consumables rnasecure rnase inactivation reagent , h4434 methocult classic , corning non treated culture dishes , syringe pp by pe without needle , laboratory pipetting needle with 90 blunt ends , rpl5 polyclonal antibody , qubit

Due Date : Feb 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mumbai - Maharashtra

47363450 Corrigendum : tender for supply of laboratory instruments purchase in the year 2024 2025 for food and drug administration laboratory m.s. mumbai fdal/instru.part a/36/2024 25/05

Due Date : Feb 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - wardha - Maharashtra

47328852 Corrigendum : tender for supply of medical equipment

Due Date : Feb 1, 2025

Tender Value : Ref. Document

View Notice

Government Departments - rasayani - Maharashtra

47323422 tender for qc items (pr 2463)

Due Date : Feb 10, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Raigad - Maharashtra

47267687 bids are invited for chromatography mse atlantis t3 3pm , nova pak c18 , s5ods2 col , symmetry c18 , xterra phenyl , xselect hss cyano , rcm 8x10 cartridge holder , resolve c18 , nova pak c8 ss column , f and i charge , hplc columns (high pressure li

Due Date : Feb 8, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Pune - Maharashtra

47241298 bids are invited for fluorescence detector as an accessory for existing hplc unit , high performance liquid chromatography (hplc) system total quantity : 1

Due Date : Feb 7, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - nagpur - Maharashtra

47226834 tender for procurement of labsolutions software for existing hplc system compatible

Due Date : Feb 4, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Pune - Maharashtra

47217103 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Feb 6, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mumbai Suburban - Maharashtra

47213271 bids are invited for customized amc/cmc for pre owned products quatenary hplc; y l instruments; annual maintenance contract (amc); six monthly; no total quantity :

Due Date : Feb 4, 2025

Tender Value :

1.43 Lakhs

View Notice

Government Departments - Mumbai Suburban - Maharashtra

47209310 bids are invited for oligomycin a> = 99% (hplc) mg cat no. 731 make sigma , paraquat dichloride hydrate pestanal , mdivi 1 , anti hk2 , monoclonal anti flag , anti human globulin (ahg) sera total quantity : 5

Due Date : Feb 6, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Pune - Maharashtra

47204856 Corrigendum : bids are invited for flash chromatography , high performance liquid chromatography (hplc) system total quantity : 1

Due Date : Feb 14, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

47189220 bids are invited for chemicals sigma make mse n n dimethylformamide , triammonium citrate , ethyl acetate , sodium acetate, anhydrous, , potassium hydroxide, reagent grade, , dipotassium hydrogen phosphate, anhydrous, , ammonium sulfate, acs reagent

Due Date : Feb 5, 2025

Tender Value :

3.50 Lakhs

View Notice

Government Departments - Mumbai Suburban - Maharashtra

47187067 bids are invited for one step rt qpcr kit for detection and quantitation of rna , opti mem reduced serum medium. 100 ml , rnai transfection reagent 0.75ml , n methyl mesoporphyrin ix .nmm . , pyridostatin hydrochloride greater than98percent . hplc . ,

Due Date : Feb 4, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Mumbai - Maharashtra

47160008 tender for purchase of acetonitrile hplc grade required for therapeutic drug monitoring system

Due Date : Jan 17, 2025

Tender Value :

2.95 Lakhs

View Notice

Government Departments - Thane - Maharashtra

47147260 Corrigendum : bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Jan 25, 2025

Tender Value :

2.50 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

47136140 bids are invited for ethyl acetate (q3) , acetonitrile (q3) , diethyl ether (q3) , tetrahydrofuran hplc grade (q3) , toluene as per is 537 (q3) , hydrochloric acid as per is 265 (q3) , diphenylamine is 8278 (q3) , cyclohexane (q3) total quantity :

Due Date : Jan 31, 2025

Tender Value : Ref. Document

View Notice

Local Bodies - Aurangabad - Maharashtra

47122627 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Jan 20, 2025

Tender Value :

1.04 Crore

View Notice

Local Bodies - Mumbai - Maharashtra

47113742 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Feb 7, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Pune - Maharashtra

47112812 tender enquiry for lab chemicals

Due Date : Jan 28, 2025

Tender Value :

12000.0

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

47077856 Corrigendum : bids are invited for customized amc/cmc for pre owned products variant ii analyzer gold sr no 15202 biorad varient ii hplc; variant ii analyzer gold sr no 15202 biorad varient ii hplc; comprehensive maintenance contract (cmc); quarterly; no total qu

Due Date : Feb 11, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - gadchiroli - Maharashtra

47072347 tender for procurement of various scientific equipment under pm usha at gondwana university gadchiroli. , hplc system (50/60 hz – 220 v ac – metallic): hplc pump (lc 10at vp): flow rate range 0.001ml /min to 9.0ml/min max. operating pressure 400 kgf man

Due Date : Jan 21, 2025

Tender Value :

7 Lakhs

View Notice

Boards / Undertakings / PSU - Nagpur - Maharashtra

47011710 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Jan 27, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

47009015 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 1

Due Date : Jan 27, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

47006380 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 2

Due Date : Jan 28, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

47006237 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 2

Due Date : Jan 27, 2025

Tender Value :

1 Lakhs

View Notice

Boards / Undertakings / PSU - Solapur - Maharashtra

46992219 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Jan 11, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46958826 bids are invited for hplc dosage unit total quantity : 1

Due Date : Jan 20, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46926491 bids are invited for histopathology consumables iron stain_kit of 50 test , grocott_s methinamine silver stain , harris_s haematoxylin , masson trichome stain , pas stain , reticulin_nuclear fast red , methanol fixative , methyl alcohol hplc grade_bo

Due Date : Jan 18, 2025

Tender Value :

6.85 Lakhs

View Notice

Government Departments - mumbai - Maharashtra

46882602 Corrigendum : tender for supply of laboratory basic instruments purchase in the year 2024 2025 for food and drug administration laboratory m.s.

Due Date : Jan 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - goregaon - Maharashtra

46814149 Corrigendum : supply of laboratory media, consumables, pcr kits etc

Due Date : Jan 23, 2025

Tender Value :

32 Lakhs

View Notice

Government Departments - Mumbai - Maharashtra

46755899 bids are invited for boq of chemicals chemicals and tlc plate 1 octane sulphonic acid , xanthydrol , sucrose ar , diethyl ether ar grade , n hexane gc grade , triethylene glycol ar , tetrahydrofurane gc grade , anhydrous ethanol ar , ethanol , n meth

Due Date : Jan 8, 2025

Tender Value :

5.25 Lakhs

View Notice

Government Departments - mumbai - Maharashtra

46752003 Corrigendum : tender for supply of laboratory instruments purchase in year 2024 2025 for food and drug administration laboratory m.s. mumbai

Due Date : Jan 16, 2025

Tender Value : Ref. Document

View Notice

Government Departments - mumbai - Maharashtra

46751556 Corrigendum : tender for supply of laboratory instruments purchase in year 2024 2025 for food and drug administration laboratory m.s. mumbai

Due Date : Jan 16, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - nagpur - Maharashtra

46691922 tender for supply of items

Due Date : Dec 26, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46677215 bids are invited for high performance liquid chromatography (hplc) system as per specifcaiton total quantity : 1

Due Date : Dec 16, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - pune - Maharashtra

46612699 Corrigendum : tender for supply and installation of hplc for detecting hemoglobinopathies to the district women hospital, dharashiv

Due Date : Jan 3, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

46528917 bids are invited for import chemical consumables for medical research mse glass fiber membrane filter 1.2um pore size , koh potassium hydroxide pellets,white , nile red , poly l lysine coated glass slides , polyoxymethylene reagent grade, crystallin

Due Date : Dec 26, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Pune - Maharashtra

46492019 tender enquiry for lab chemicals

Due Date : Dec 23, 2024

Tender Value :

18000.0

View Notice

Boards / Undertakings / PSU - gadchiroli - Maharashtra

46482233 tender for procurement of various scientific equipment under pm usha at gondwana university gadchiroli (second time)

Due Date : Dec 16, 2024

Tender Value :

1.91 Crore

View Notice

Statutory Bodies & Commissions/Committees - nagpur - Maharashtra

46387144 Corrigendum : tender for procurement of lab solutions software for existing hplc system compatible with pda detector (pda) lc detector (rf 20a)

Due Date : Dec 24, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

46380972 bids are invited for auranofin (> 98% hplc, leukocyte activation pathway inhibitor; c20h34auo9ps, mol wt. 678.48) total quantity : 100

Due Date : Dec 17, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

46352882 bids are invited for stationary sequrite end point security 50 users 3 years validity , hplc register 300 pages icmr crmch niih a , hplc register 300 pages icmr crmch niih b , hplc register 300 pages icmr crmch niih c , hplc register 300 pages icmr c

Due Date : Dec 17, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

46319966 bids are invited for consumables sysmex cell pack xp 100 20 liters , stromatolyzer sysmex 3 parts , qiaamp dna blood mini kit 250 qiagen cat no 51106 , nucleospin blood 50 kithsn code 38229090 , hpyf3i ddel 2500 units , sigma oligonucleotides 5od

Due Date : Dec 14, 2024

Tender Value : Ref. Document

View Notice

Government Departments - mumbai - Maharashtra

46244577 tender for purchase of hplc system with accessories

Due Date : Dec 9, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

46236689 bids are invited for fame standard 37 mix , undecanoic acid c 11 , n hexane , bf3 methanol , methanol hplc , gc vials , conical flask , centrifuge tube plastic disposable with lid , micropipette , water condenser for extraction of fap , air condenser

Due Date : Dec 9, 2024

Tender Value :

5.40 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46212700 bids are invited for insert vial for hplc,levetiracetam standard, hplc coloumns s46 x150x5 micron,boldine,streptozocin total quantity : 304

Due Date : Nov 18, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

46165116 bids are invited for p toluenesulfonyl chloride,fmoc l leucine,fmoc cys,dbi20 drybath incubator, hplc syringes 1710rnr,hp total quantity : 20

Due Date : Nov 15, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

46085363 bids are invited for fbs 500ml 12676029 , antifade vectasheild, 5 x 2 ml prolong diamond p36961 , sigma oligos 50d biotin labelled with hplc dry , sigma oligonucleotides 50d desalt dry , progesterone elisa kit , custom oligo nucleotides primer scale e

Due Date : Nov 29, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

46077539 bids are invited for formamide ar , tetramethylammonium h , benzoyl l arginine ethyl , mercuric acetate ar , hydroiodic acid ar grade , hexane gc grade , sodium undecanesulfonate , potassium bromide , acetone ar grade , acetonitrile hplc grade total q

Due Date : Nov 28, 2024

Tender Value :

6.75 Lakhs

View Notice

Government Departments - Mumbai - Maharashtra

46072074 Corrigendum : bids are invited for consumables custom aimplex human 13 plex panel aimplex hsn code 38229090 product code t1c1330927 ifn gamma , recombinant human il 28b by ifn lambda 3 protein 2ug 5259 il 025 r and d , human ifn beta recombinant protein 100ug pepr

Due Date : Dec 9, 2024

Tender Value : Ref. Document

View Notice

Government Departments - nagpur - Maharashtra

46045459 tender for rate contract of printing of forms, registers and miscellaneous items

Due Date : Dec 5, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

45955944 bids are invited for consumables for medical research a1780 rabbit pab 20ul , a2416 isg15 rabbit mab 20ul , a8271 rsad2 rabbit pab 20ul , p 8920 poly l lysine solution 0.1percent weight by volume in h2o , mm gapdh f aactttggcattgtggaagg hplc grade ,

Due Date : Nov 18, 2024

Tender Value :

1.25 Lakhs

View Notice

Local Bodies - Mumbai Suburban - Maharashtra

45952333 Corrigendum : bids are invited for hplc with autosampler, photo diode array and fluorescence detector total quantity : 1

Due Date : Dec 20, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Raigad - Maharashtra

45906317 bids are invited for hplcu hplc column spare for hplc luna c 18 cat no. 00f 4252 e0 standard total quantity : 2

Due Date : Nov 14, 2024

Tender Value : Ref. Document

View Notice

Government Departments - pune - Maharashtra

45904818 purchase of synthetic peptides 90% purity hplc purification, peptide 1 mg

Due Date : Oct 30, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

45854188 bids are invited for sino biological 13217 hna e 200 ferritin heavy chain1 fth1 protein, human recombinant 200ug , sino biological mg50922 ut trop2 cdna orf clone, mouse untagged , eurofins unmodified sirna hplc purified 20 nmol , immoilf30cc lo

Due Date : Nov 11, 2024

Tender Value :

1.77 Lakhs

View Notice

Local Bodies - Mumbai - Maharashtra

45770383 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Dec 20, 2024

Tender Value : Ref. Document

View Notice

Local Bodies - Mumbai - Maharashtra

45765848 Corrigendum : tender for supply of hplc 02 nos column (25 cm x 4.6 mm)

Due Date : Oct 31, 2024

Tender Value :

3 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

45760401 Corrigendum : bids are invited for annual maintenance contarct for high performance liquid chromatography machine annual maintenance contract for high performance liquid chromatography machine annual maintenance contract for networking devices (version 2) relevant

Due Date : Nov 12, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - nagpur - Maharashtra

45755032 tender for supply items

Due Date : Oct 25, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai Suburban - Maharashtra

45745397 Corrigendum : bids are invited for the thermal diffusivity measurement system the thermal diffusivity measurement system concentrated solar thermal system, solar water heating system as per is 12976:1990, night vision weapon sight (thermal) weapon mounted thermal

Due Date : Dec 13, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

45741972 bids are invited for import chemical consumables for medical research mse mak360 , primers , biotin sigma , oligo sigma , biotin labelled , sigma oligos citrate synthase activity assay kit, mitochondrial complex iii activity assay ki, oligonucleotid

Due Date : Nov 5, 2024

Tender Value : Ref. Document

View Notice

Government Departments - goregaon - Maharashtra

45739007 Corrigendum : tender for supply of laboratory media, consumables, pcr kits

Due Date : Nov 5, 2024

Tender Value :

32 Lakhs

View Notice

Boards / Undertakings / PSU - kolhapur - Maharashtra

45730528 tender for annual rate contract for supply of chemical , across , alfa aesar , avra sytheesis , axiva sichem/ organic , benglore geni , eurofin , finar , filtrum fiber , fisher , hi – media , hplc , invitrogen , lancaster , loba , merck , molychem , palla

Due Date : Oct 29, 2024

Tender Value :

87.85 Lakhs

View Notice

Boards / Undertakings / PSU - gadchiroli - Maharashtra

45727918 tender for procurement of various scientific equipment under pm usha at gondwana university gadchiroli

Due Date : Oct 28, 2024

Tender Value :

2.39 Crore

View Notice

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

45714605 bids are invited for annual indent mse acetic acid glacial, 2.5 litres , acetone, 2.5 litres , chloroform ,2.5 litres , sodium borohydride, 500 gram , water, 2.5 litres , 100 ml conical flask , pipette bulb , retort ring 9 cm diameter , reagent bottle, 20

Due Date : Nov 2, 2024

Tender Value :

5.28 Lakhs

View Notice

Government Departments - Mumbai - Maharashtra

45705219 bids are invited for consumables varianttm ii b thalassemia short program pack 00 tests , biorad variant ii hplc kits a hsn code 38220090 , biorad variant ii hplc kits b hsn code 38220090 , biorad variant ii hplc kits c hsn code 38220090 , eqas he

Due Date : Nov 2, 2024

Tender Value :

5 Lakhs

View Notice

Local Bodies - Mumbai - Maharashtra

45677632 Corrigendum : tender for purchase of hplc column therapeutic drug monitoring system

Due Date : Dec 4, 2024

Tender Value :

3 Lakhs

View Notice

Government Departments - Mumbai Suburban - Maharashtra

45606240 bids are invited for high level instrument disinfectant high level instrument disinfectant high level medical device disinfectant, high performance power supplies, sound level meter noise level meter (sound measuring apparatus or decibel meter), digi

Due Date : Oct 29, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

45566359 Corrigendum : bids are invited for fraction collector and sample injector for hplc system fraction collector and sample injector for hplc system injector diagnosis and cleaning system kit for educational purpose relevant high performance liquid chromatography (hpl

Due Date : Nov 18, 2024

Tender Value : Ref. Document

View Notice

Local Bodies - Aurangabad - Maharashtra

45493257 Corrigendum : bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Nov 21, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Solapur - Maharashtra

45493256 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Oct 10, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

45489183 bids are invited for automated power backup system as per specification no. hemrltegups202401 gemarpts searched automated power backup system strings used in gemarpts portable mobile lab with power backup, online ups (v2), automated bacterial identif

Due Date : Oct 29, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

45486370 bids are invited for lab chemicals for pg lab and hplc lab insert vial for hplc , levetiracetam standard , hplc coloumns s46 x150x5 micron , boldine , streptozocin insert_vial_for_hplc, levetiracetam_standard, gemarpts searched hplc_coloumns_s_46 int

Due Date : Oct 21, 2024

Tender Value :

1.22 Lakhs

View Notice

Government Departments - Mumbai - Maharashtra

45483929 bids are invited for boq of chemicals hexane ar grade , tetrahydrofurane ar grade , tetrahydrofurane hplc grade , hydrochloric acid ar grade , triethanolamine ar grade , heptane ar grade , sodium chloride ar , karl fischer titrant , sodium dihydrogen

Due Date : Oct 21, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Chandrapur - Maharashtra

45483628 Corrigendum : bids are invited for automation system of diesel bowser gemarpts searched automation of diesel bowser with existing flowmeter strings used in gemarpts spirometer, water sprinkler application mounted on water gemarpts searched truck cabin truck with w

Due Date : Nov 4, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Nashik - Maharashtra

45453236 Corrigendum : bids are invited for high performance butterfly valve high performance butterfly valve 1 , high performance butterfly valve 2 , high performance butterfly valve 3 , high performance butterfly valve 4 , high performance butterfly valve 5 gemarpts sear

Due Date : Oct 15, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Mumbai - Maharashtra

45428280 bids are invited for consumables for medical research blue star coverslips rectangural 22x60mm thickness 0.13mm to 0.16mm , blue star coverslips square 22x22mm thickness 0.13mm to 0.16mm 10 grams each packet , blue star coverslips round 18mm thicknes

Due Date : Oct 17, 2024

Tender Value :

2.51 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

45421809 bids are invited for steriliser, steam, high pressure complete, 040 203 gemarpts searched steriliser, steam, high pressure complete strings used in gemarpts high pressure washer, portable fire extinguishers (v2) as per is 15683:2018, high temperature

Due Date : Oct 17, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - nagpur - Maharashtra

45408471 tender for supply of items

Due Date : Oct 10, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - nagpur - Maharashtra

45385212 tender for supply of items

Due Date : Oct 4, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - nagpur - Maharashtra

45385205 supply of following items, 1.. c18 hplc column 2. pcr workstation 3. microscope filters

Due Date : Oct 4, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Amravati - Maharashtra

45384835 tender for supply of laboratory chemicals

Due Date : Oct 5, 2024

Tender Value : Ref. Document

View Notice

100

Boards / Undertakings / PSU - Pune - Maharashtra

45362633 tender for lab chemicals; 1 iron (iii) chloride hexahydrate ar grade (fecl36h2o) mol. wt. 270.33 gm 500(250 x 2) 2 methanol hplc grade ltr 25 (2.5 x 10) 3 methanol ar grade ltr 25 (2.5x 10)

Due Date : Oct 11, 2024

Tender Value :

20000.0

View Notice

Tell us about your Product / Services,
We will Find Tenders for you

Tenders By City

Top