1145 Hplc tenders in Maharashtra 2025

Get latest Hplc related Tenders, online published by Bank Of Maharashtra, Cidco Maharashtra Ltd., City and Industrial Development Corporation of Maharashtra from Maharashtra state. Participate online through e-Procurement website for Hplc tenders in Maharashtra. Download Tender Documents, BOQ, Technical Bids for Hplc related Tenders from Maharashtra. Get Bidding support for etenders related to Hplc Tenders in Maharashtra. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Hplc tenders published from Maharashtra. Also get daily email alerts for Hplc related tender notices published by Government of Maharashtra.

1

Boards / Undertakings / PSU - Mumbai - Maharashtra

48038655 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Mar 18, 2025
Tender Value : Ref. Document
View Notice
2

Government Departments - Mumbai - Maharashtra

47998705 bids are invited for hplc column l8 amino 15 cm x 4 6 mm 3um , l13 c1 25 cm x 4 6 mm 5um , l1 c18 25 cm x 4 6 mm 5um xterra ms , l7 c8 25 cm x 4 6 mm 3 um , l7 c8 25 cm x 4 6 mm 5 um , l7 c8 15 cm x 4 6 mm 5 um amonopropyl silane hplc column 15 cm 4.

Due Date : Mar 21, 2025
Tender Value : rupee 5.50 Lakhs
View Notice
3

Boards / Undertakings / PSU - Nagpur - Maharashtra

47937949 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Mar 8, 2025
Tender Value : Ref. Document
View Notice
4

Boards / Undertakings / PSU - pune - Maharashtra

47931028 tender for procurement of hplc system with uv visible detector

Due Date : Mar 19, 2025
Tender Value : rupee 44.67 Lakhs
View Notice
5

Government Departments - Nagpur - Maharashtra

47930512 tender for proposal for purchase of nvbs hplc analyzer to perform newborn screening for hemoglobinopathy at dried blood spot for department of pathology at aiims nagpur inviting comments/objection thereon

Due Date : Mar 10, 2025
Tender Value : Ref. Document
View Notice
6

Government Departments - Pune - Maharashtra

47919952 bids are invited for molecular biology , 1 heptanesulphonic acid sodium salt anhydrous for hplc , hepes for molecular biology , plant tissue culture container with cap , l shaped spreader sterile , test tube cap 25 mm plopropylene autoclavable , para

Due Date : Mar 17, 2025
Tender Value : rupee 3.85 Lakhs
View Notice
7

Government Departments - Pune - Maharashtra

47895943 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Mar 4, 2025
Tender Value : Ref. Document
View Notice
8

Government Departments - Mumbai Suburban - Maharashtra

47871419 bids are invited for ferrostatin 1, purity of more than 95 percent by hplc, 25 mg in vial , erastin, purity of more than 98 percent by hplc, 5 mg in vial , rsl 3, purity of more than 98 percent by hplc, 25 mg in vial , liproxstatin 1, purity of more

Due Date : Mar 19, 2025
Tender Value : Ref. Document
View Notice
9

Boards / Undertakings / PSU - Ratnagiri - Maharashtra

47869329 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Mar 3, 2025
Tender Value : Ref. Document
View Notice
10

Government Departments - Nagpur - Maharashtra

47865913 bids are invited for liquid chromatograph mass spectrometer(lc msms) , hplc columns (high pressure liquid chromatography) total quantity : 1

Due Date : Mar 13, 2025
Tender Value : Ref. Document
View Notice
11

Government Departments - Mumbai Suburban - Maharashtra

47839752 bids are invited for cox 2 antibody, mouse monoclonal antibody, clone number d 12, igg1 k, one vial contain 200 microgram , recombinant human interleukin 1beta protein (or il 1beta protein, > 98% (sds page and hplc) , interferon g protein (or ifn gam

Due Date : Mar 13, 2025
Tender Value : Ref. Document
View Notice
12

Statutory Bodies & Commissions/Committees - mumbai - Maharashtra

47813686 tender for supply of hplc equipment.

Due Date : Mar 5, 2025
Tender Value : Ref. Document
View Notice
13

Government Departments - Pune - Maharashtra

47811035 bids are invited for apparatus for fully closed waste collection manifold system for gpc, hplc and particle size analyzer , diagnostic reader for mycotoxins and dairy antibiotics total quantity : 3

Due Date : Mar 11, 2025
Tender Value : Ref. Document
View Notice
14

Government Departments - Pune - Maharashtra

47809987 bids are invited for ethyl acetate,acetonitrile,diethyl ether,tetrahydrofuran hplc grade,toluene as per is 537,hydrochlo total quantity : 276

Due Date : Feb 21, 2025
Tender Value : Ref. Document
View Notice
15

Statutory Bodies & Commissions/Committees - jalna - Maharashtra

47767268 tender for e tender for supply of equipment and instruments at govt. medical college jalna

Due Date : Feb 28, 2025
Tender Value : Ref. Document
View Notice
16

Local Bodies - Amravati - Maharashtra

47765991 bids are invited for automated hplc system for separation of complex mixtures (q3) ( pac only ) total quantity : 1

Due Date : Feb 25, 2025
Tender Value : Ref. Document
View Notice
17

Statutory Bodies & Commissions/Committees - Nandurbar - Maharashtra

47765460 Corrigendum : supply of medical equipments government medical college, civil hospital campus, sakri road, nandurbar

Due Date : Mar 6, 2025
Tender Value : rupee 2.56 Crore
View Notice
18

Boards / Undertakings / PSU - Nagpur - Maharashtra

47750523 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Feb 24, 2025
Tender Value : Ref. Document
View Notice
19

Local Bodies - Mumbai Suburban - Maharashtra

47747079 bids are invited for high performance liquid chromatography , high performance thin layer chromatography (hptlc) high performance liquid chromatography (hplc) system total quantity : 1

Due Date : Mar 7, 2025
Tender Value : Ref. Document
View Notice
20

Government Departments - Mumbai - Maharashtra

47744075 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 2

Due Date : Mar 6, 2025
Tender Value : rupee 1 Lakhs
View Notice
21

Government Departments - Mumbai - Maharashtra

47744023 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 2

Due Date : Mar 6, 2025
Tender Value : rupee 1.50 Lakhs
View Notice
22

Government Departments - Mumbai - Maharashtra

47743913 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 3

Due Date : Mar 6, 2025
Tender Value : rupee 1.50 Lakhs
View Notice
23

Government Departments - Pune - Maharashtra

47640465 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Feb 18, 2025
Tender Value : Ref. Document
View Notice
24

Government Departments - kharghar - Maharashtra

47632646 tender for design, support, supply, installation and commissioning, training, warranty and amc of medical cyclotron with turnkey

Due Date : Mar 24, 2025
Tender Value : Ref. Document
View Notice
25

Government Departments - Nagpur - Maharashtra

47609937 bids are invited for boron trifluoride 500 ml , chloroform hplc grade 500 ml , hexane ar grade , petrolium ether , sodium sulfate ar total quantity : 42

Due Date : Feb 27, 2025
Tender Value : rupee 5 Lakhs
View Notice
26

Government Departments - Mumbai - Maharashtra

47595386 bids are invited for consumables precicontrol clinchem multi 1 roche 5ml , precicontrol clinchem multi 2 roche 5ml , cleaner cobas integra or cobas c111 roche 1000 ml , ise deproteinizer c111 , ambion depc treated water , takara emrald gt pcr master

Due Date : Feb 28, 2025
Tender Value : Ref. Document
View Notice
27

Government Departments - Mumbai Suburban - Maharashtra

47574902 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Feb 26, 2025
Tender Value : Ref. Document
View Notice
28

Government Departments - Mumbai - Maharashtra

47569741 bids are invited for stationary venishing blinds , hplc register 300 pages icmr crmch niih a , hplc register 300 pages icmr crmch niih b , hplc register 300 pages icmr crmch niih d , hplc register 300 pages icmr crmch niih e , hplc register 300 pages

Due Date : Feb 27, 2025
Tender Value : Ref. Document
View Notice
29

Boards / Undertakings / PSU - mumbai - Maharashtra

47544436 tender for annual rate contract for supply of laboratory research chemicals/ glassware / plastic ware / consumables/hp cartridges (product category as per chapter no 2 of this bid document)

Due Date : Feb 24, 2025
Tender Value : rupee 30 Lakhs
View Notice
30

Government Departments - mumbai - Maharashtra

47504080 Corrigendum : tender for supply of laboratory instruments group c , item description (refer tender document for details) , hplc , polari meter , tintometer , water purification system , flame photometer

Due Date : Feb 27, 2025
Tender Value : Ref. Document
View Notice
31

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

47449452 bids are invited for chemicals ethanol ar grade pack of 500 ml , oxone synthesis grade pack of 250 g , dried methanol hplc grade pack of 500 ml , sodium nitrate synthesis grade pack of 500 g , sodium hydroxide synthesis grade pack of 500 g , potassiu

Due Date : Feb 20, 2025
Tender Value : Ref. Document
View Notice
32

Local Bodies - Mumbai - Maharashtra

47425336 Corrigendum : tender for purchase of acetonitrile hplc grade required for therapeutic drug monitoring system

Due Date : Feb 20, 2025
Tender Value : rupee 2.95 Lakhs
View Notice
33

Government Departments - Mumbai - Maharashtra

47425213 bids are invited for consumables cryo box 100 wells , cryo box 50 wells , transparent micro centrifuges tubes 1 5 ml abdos pack of 1000 no s , amber micro centrifuges tubes 1 5 ml abdos pack of 1000 no s , white blotting paper sheets for general labo

Due Date : Feb 19, 2025
Tender Value : Ref. Document
View Notice
34

Government Departments - Mumbai - Maharashtra

47415329 bids are invited for hplc column boq 2 10 l8 amino 15 cmx 4 6 mm x 3um , l82 15 cm x 4 6 mm x 5 um , l13 c1 250 cm x 46 x5 um , l61 25 cm x 2 mm , l1 25 cm x 4 6x 5 um , l40 25 cmx 4 6x5um , l7 octylsilane 25 cm x 4 6 3 um aminopropylsilane 15 cmx 4.

Due Date : Feb 18, 2025
Tender Value : rupee 7.10 Lakhs
View Notice
35

Government Departments - Mumbai - Maharashtra

47414724 bids are invited for consumables geneall column type d , ez 10 dna gel extraction kit , biorad variant ii hplc kits a hsn code 38220090 , hpyf3i ddel 500 units , sigma oligos 5od hplc purified , consumables for digital duplicators total quantity : 10

Due Date : Feb 18, 2025
Tender Value : Ref. Document
View Notice
36

Government Departments - Mumbai - Maharashtra

47412059 bids are invited for consumables hplc with pda detector for amino acid profiling , cyt inf d , cyt inf efdb 20 , dfs taq polymerase bioron 500 units , 4you4 dntp mix 10mm each 200ul , taqara ex taq polymerase hot start 250 unit , qiagen multiplex pcr

Due Date : Feb 18, 2025
Tender Value : Ref. Document
View Notice
37

Boards / Undertakings / PSU - Thane - Maharashtra

47411795 bids are invited for boq titanium sheet autostainer , liquid based , electrophorosis , hplc , manual rotary microtome , automated rotary microtome , paraffin embbedding bath , heated paraffine embbedding module , automated tissue processor histokinet

Due Date : Feb 17, 2025
Tender Value : rupee 1.66 Crore
View Notice
38

Government Departments - Mumbai - Maharashtra

47397429 bids are invited for stationary oligonucleotide primers hplc purified , oligonucleotide primers for qpcr hplc purified , applied biosystems powerup sybr green master mix for qpcr 100rxns 1ml , dnase i rnase free , sigma oligos 50d dry desalted , stat

Due Date : Feb 18, 2025
Tender Value : Ref. Document
View Notice
39

Government Departments - Mumbai - Maharashtra

47365612 bids are invited for consumables rnasecure rnase inactivation reagent , h4434 methocult classic , corning non treated culture dishes , syringe pp by pe without needle , laboratory pipetting needle with 90 blunt ends , rpl5 polyclonal antibody , qubit

Due Date : Feb 15, 2025
Tender Value : Ref. Document
View Notice
40

Government Departments - mumbai - Maharashtra

47363450 Corrigendum : tender for supply of laboratory instruments purchase in the year 2024 2025 for food and drug administration laboratory m.s. mumbai fdal/instru.part a/36/2024 25/05

Due Date : Feb 21, 2025
Tender Value : Ref. Document
View Notice
41

Statutory Bodies & Commissions/Committees - wardha - Maharashtra

47328852 Corrigendum : tender for supply of medical equipment

Due Date : Feb 1, 2025
Tender Value : Ref. Document
View Notice
42

Government Departments - rasayani - Maharashtra

47323422 tender for qc items (pr 2463)

Due Date : Feb 10, 2025
Tender Value : Ref. Document
View Notice
43

Statutory Bodies & Commissions/Committees - Raigad - Maharashtra

47267687 Corrigendum : bids are invited for chromatography mse atlantis t3 3pm , nova pak c18 , s5ods2 col , symmetry c18 , xterra phenyl , xselect hss cyano , rcm 8x10 cartridge holder , resolve c18 , nova pak c8 ss column , f and i charge , hplc columns (high pressure li

Due Date : Feb 25, 2025
Tender Value : Ref. Document
View Notice
44

Government Departments - Pune - Maharashtra

47241298 Corrigendum : bids are invited for fluorescence detector as an accessory for existing hplc unit , high performance liquid chromatography (hplc) system total quantity : 1

Due Date : Feb 19, 2025
Tender Value : Ref. Document
View Notice
45

Statutory Bodies & Commissions/Committees - nagpur - Maharashtra

47226834 tender for procurement of labsolutions software for existing hplc system compatible

Due Date : Feb 4, 2025
Tender Value : Ref. Document
View Notice
46

Government Departments - Pune - Maharashtra

47217103 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Feb 6, 2025
Tender Value : Ref. Document
View Notice
47

Boards / Undertakings / PSU - Mumbai Suburban - Maharashtra

47213271 bids are invited for customized amc/cmc for pre owned products quatenary hplc; y l instruments; annual maintenance contract (amc); six monthly; no total quantity :

Due Date : Feb 4, 2025
Tender Value : rupee 1.43 Lakhs
View Notice
48

Government Departments - Mumbai Suburban - Maharashtra

47209310 bids are invited for oligomycin a> = 99% (hplc) mg cat no. 731 make sigma , paraquat dichloride hydrate pestanal , mdivi 1 , anti hk2 , monoclonal anti flag , anti human globulin (ahg) sera total quantity : 5

Due Date : Feb 6, 2025
Tender Value : Ref. Document
View Notice
49

Government Departments - Pune - Maharashtra

47204856 Corrigendum : bids are invited for flash chromatography , high performance liquid chromatography (hplc) system total quantity : 1

Due Date : Feb 14, 2025
Tender Value : Ref. Document
View Notice
50

Government Departments - Mumbai - Maharashtra

47189220 bids are invited for chemicals sigma make mse n n dimethylformamide , triammonium citrate , ethyl acetate , sodium acetate, anhydrous, , potassium hydroxide, reagent grade, , dipotassium hydrogen phosphate, anhydrous, , ammonium sulfate, acs reagent

Due Date : Feb 5, 2025
Tender Value : rupee 3.50 Lakhs
View Notice
51

Government Departments - Mumbai Suburban - Maharashtra

47187067 bids are invited for one step rt qpcr kit for detection and quantitation of rna , opti mem reduced serum medium. 100 ml , rnai transfection reagent 0.75ml , n methyl mesoporphyrin ix .nmm . , pyridostatin hydrochloride greater than98percent . hplc . ,

Due Date : Feb 4, 2025
Tender Value : Ref. Document
View Notice
52

Local Bodies - Mumbai - Maharashtra

47160008 tender for purchase of acetonitrile hplc grade required for therapeutic drug monitoring system

Due Date : Jan 17, 2025
Tender Value : rupee 2.95 Lakhs
View Notice
53

Government Departments - Thane - Maharashtra

47147260 Corrigendum : bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Jan 25, 2025
Tender Value : rupee 2.50 Lakhs
View Notice
54

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

47136140 bids are invited for ethyl acetate (q3) , acetonitrile (q3) , diethyl ether (q3) , tetrahydrofuran hplc grade (q3) , toluene as per is 537 (q3) , hydrochloric acid as per is 265 (q3) , diphenylamine is 8278 (q3) , cyclohexane (q3) total quantity :

Due Date : Jan 31, 2025
Tender Value : Ref. Document
View Notice
55

Local Bodies - Aurangabad - Maharashtra

47122627 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Jan 20, 2025
Tender Value : rupee 1.04 Crore
View Notice
56

Local Bodies - Mumbai - Maharashtra

47113742 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Feb 7, 2025
Tender Value : Ref. Document
View Notice
57

Boards / Undertakings / PSU - Pune - Maharashtra

47112812 tender enquiry for lab chemicals

Due Date : Jan 28, 2025
Tender Value : rupee 12000.0
View Notice
58

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

47077856 Corrigendum : bids are invited for customized amc/cmc for pre owned products variant ii analyzer gold sr no 15202 biorad varient ii hplc; variant ii analyzer gold sr no 15202 biorad varient ii hplc; comprehensive maintenance contract (cmc); quarterly; no total qu

Due Date : Feb 11, 2025
Tender Value : Ref. Document
View Notice
59

Boards / Undertakings / PSU - gadchiroli - Maharashtra

47072347 tender for procurement of various scientific equipment under pm usha at gondwana university gadchiroli. , hplc system (50/60 hz – 220 v ac – metallic): hplc pump (lc 10at vp): flow rate range 0.001ml /min to 9.0ml/min max. operating pressure 400 kgf man

Due Date : Jan 21, 2025
Tender Value : rupee 7 Lakhs
View Notice
60

Boards / Undertakings / PSU - Nagpur - Maharashtra

47011710 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Jan 27, 2025
Tender Value : Ref. Document
View Notice
61

Government Departments - Mumbai - Maharashtra

47009015 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 1

Due Date : Jan 27, 2025
Tender Value : Ref. Document
View Notice
62

Government Departments - Mumbai - Maharashtra

47006380 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 2

Due Date : Jan 28, 2025
Tender Value : Ref. Document
View Notice
63

Government Departments - Mumbai - Maharashtra

47006237 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 2

Due Date : Jan 27, 2025
Tender Value : rupee 1 Lakhs
View Notice
64

Boards / Undertakings / PSU - Solapur - Maharashtra

46992219 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Jan 11, 2025
Tender Value : Ref. Document
View Notice
65

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46958826 bids are invited for hplc dosage unit total quantity : 1

Due Date : Jan 20, 2025
Tender Value : Ref. Document
View Notice
66

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46926491 bids are invited for histopathology consumables iron stain_kit of 50 test , grocott_s methinamine silver stain , harris_s haematoxylin , masson trichome stain , pas stain , reticulin_nuclear fast red , methanol fixative , methyl alcohol hplc grade_bo

Due Date : Jan 18, 2025
Tender Value : rupee 6.85 Lakhs
View Notice
67

Government Departments - mumbai - Maharashtra

46882602 Corrigendum : tender for supply of laboratory basic instruments purchase in the year 2024 2025 for food and drug administration laboratory m.s.

Due Date : Jan 16, 2025
Tender Value : Ref. Document
View Notice
68

Government Departments - goregaon - Maharashtra

46814149 Corrigendum : supply of laboratory media, consumables, pcr kits etc

Due Date : Jan 23, 2025
Tender Value : rupee 32 Lakhs
View Notice
69

Government Departments - Mumbai - Maharashtra

46755899 bids are invited for boq of chemicals chemicals and tlc plate 1 octane sulphonic acid , xanthydrol , sucrose ar , diethyl ether ar grade , n hexane gc grade , triethylene glycol ar , tetrahydrofurane gc grade , anhydrous ethanol ar , ethanol , n meth

Due Date : Jan 8, 2025
Tender Value : rupee 5.25 Lakhs
View Notice
70

Government Departments - mumbai - Maharashtra

46752003 Corrigendum : tender for supply of laboratory instruments purchase in year 2024 2025 for food and drug administration laboratory m.s. mumbai

Due Date : Jan 16, 2025
Tender Value : Ref. Document
View Notice
71

Government Departments - mumbai - Maharashtra

46751556 Corrigendum : tender for supply of laboratory instruments purchase in year 2024 2025 for food and drug administration laboratory m.s. mumbai

Due Date : Jan 16, 2025
Tender Value : Ref. Document
View Notice
72

Boards / Undertakings / PSU - nagpur - Maharashtra

46691922 tender for supply of items

Due Date : Dec 26, 2024
Tender Value : Ref. Document
View Notice
73

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46677215 bids are invited for high performance liquid chromatography (hplc) system as per specifcaiton total quantity : 1

Due Date : Dec 16, 2024
Tender Value : Ref. Document
View Notice
74

Boards / Undertakings / PSU - pune - Maharashtra

46612699 Corrigendum : tender for supply and installation of hplc for detecting hemoglobinopathies to the district women hospital, dharashiv

Due Date : Jan 3, 2025
Tender Value : Ref. Document
View Notice
75

Government Departments - Mumbai - Maharashtra

46528917 bids are invited for import chemical consumables for medical research mse glass fiber membrane filter 1.2um pore size , koh potassium hydroxide pellets,white , nile red , poly l lysine coated glass slides , polyoxymethylene reagent grade, crystallin

Due Date : Dec 26, 2024
Tender Value : Ref. Document
View Notice
76

Boards / Undertakings / PSU - Pune - Maharashtra

46492019 tender enquiry for lab chemicals

Due Date : Dec 23, 2024
Tender Value : rupee 18000.0
View Notice
77

Boards / Undertakings / PSU - gadchiroli - Maharashtra

46482233 tender for procurement of various scientific equipment under pm usha at gondwana university gadchiroli (second time)

Due Date : Dec 16, 2024
Tender Value : rupee 1.91 Crore
View Notice
78

Statutory Bodies & Commissions/Committees - nagpur - Maharashtra

46387144 Corrigendum : tender for procurement of lab solutions software for existing hplc system compatible with pda detector (pda) lc detector (rf 20a)

Due Date : Dec 24, 2024
Tender Value : Ref. Document
View Notice
79

Government Departments - Mumbai Suburban - Maharashtra

46380972 bids are invited for auranofin (> 98% hplc, leukocyte activation pathway inhibitor; c20h34auo9ps, mol wt. 678.48) total quantity : 100

Due Date : Dec 17, 2024
Tender Value : Ref. Document
View Notice
80

Government Departments - Mumbai - Maharashtra

46352882 bids are invited for stationary sequrite end point security 50 users 3 years validity , hplc register 300 pages icmr crmch niih a , hplc register 300 pages icmr crmch niih b , hplc register 300 pages icmr crmch niih c , hplc register 300 pages icmr c

Due Date : Dec 17, 2024
Tender Value : Ref. Document
View Notice
81

Government Departments - Mumbai - Maharashtra

46319966 bids are invited for consumables sysmex cell pack xp 100 20 liters , stromatolyzer sysmex 3 parts , qiaamp dna blood mini kit 250 qiagen cat no 51106 , nucleospin blood 50 kithsn code 38229090 , hpyf3i ddel 2500 units , sigma oligonucleotides 5od

Due Date : Dec 14, 2024
Tender Value : Ref. Document
View Notice
82

Government Departments - mumbai - Maharashtra

46244577 tender for purchase of hplc system with accessories

Due Date : Dec 9, 2024
Tender Value : Ref. Document
View Notice
83

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

46236689 bids are invited for fame standard 37 mix , undecanoic acid c 11 , n hexane , bf3 methanol , methanol hplc , gc vials , conical flask , centrifuge tube plastic disposable with lid , micropipette , water condenser for extraction of fap , air condenser

Due Date : Dec 9, 2024
Tender Value : rupee 5.40 Lakhs
View Notice
84

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

46212700 bids are invited for insert vial for hplc,levetiracetam standard, hplc coloumns s46 x150x5 micron,boldine,streptozocin total quantity : 304

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
85

Government Departments - Mumbai Suburban - Maharashtra

46165116 bids are invited for p toluenesulfonyl chloride,fmoc l leucine,fmoc cys,dbi20 drybath incubator, hplc syringes 1710rnr,hp total quantity : 20

Due Date : Nov 15, 2024
Tender Value : Ref. Document
View Notice
86

Government Departments - Mumbai - Maharashtra

46085363 bids are invited for fbs 500ml 12676029 , antifade vectasheild, 5 x 2 ml prolong diamond p36961 , sigma oligos 50d biotin labelled with hplc dry , sigma oligonucleotides 50d desalt dry , progesterone elisa kit , custom oligo nucleotides primer scale e

Due Date : Nov 29, 2024
Tender Value : Ref. Document
View Notice
87

Government Departments - Mumbai - Maharashtra

46077539 bids are invited for formamide ar , tetramethylammonium h , benzoyl l arginine ethyl , mercuric acetate ar , hydroiodic acid ar grade , hexane gc grade , sodium undecanesulfonate , potassium bromide , acetone ar grade , acetonitrile hplc grade total q

Due Date : Nov 28, 2024
Tender Value : rupee 6.75 Lakhs
View Notice
88

Government Departments - Mumbai - Maharashtra

46072074 Corrigendum : bids are invited for consumables custom aimplex human 13 plex panel aimplex hsn code 38229090 product code t1c1330927 ifn gamma , recombinant human il 28b by ifn lambda 3 protein 2ug 5259 il 025 r and d , human ifn beta recombinant protein 100ug pepr

Due Date : Dec 9, 2024
Tender Value : Ref. Document
View Notice
89

Government Departments - nagpur - Maharashtra

46045459 tender for rate contract of printing of forms, registers and miscellaneous items

Due Date : Dec 5, 2024
Tender Value : Ref. Document
View Notice
90

Government Departments - Mumbai - Maharashtra

45955944 bids are invited for consumables for medical research a1780 rabbit pab 20ul , a2416 isg15 rabbit mab 20ul , a8271 rsad2 rabbit pab 20ul , p 8920 poly l lysine solution 0.1percent weight by volume in h2o , mm gapdh f aactttggcattgtggaagg hplc grade ,

Due Date : Nov 18, 2024
Tender Value : rupee 1.25 Lakhs
View Notice
91

Local Bodies - Mumbai Suburban - Maharashtra

45952333 Corrigendum : bids are invited for hplc with autosampler, photo diode array and fluorescence detector total quantity : 1

Due Date : Dec 20, 2024
Tender Value : Ref. Document
View Notice
92

Government Departments - Raigad - Maharashtra

45906317 bids are invited for hplcu hplc column spare for hplc luna c 18 cat no. 00f 4252 e0 standard total quantity : 2

Due Date : Nov 14, 2024
Tender Value : Ref. Document
View Notice
93

Government Departments - pune - Maharashtra

45904818 purchase of synthetic peptides 90% purity hplc purification, peptide 1 mg

Due Date : Oct 30, 2024
Tender Value : Ref. Document
View Notice
94

Government Departments - Mumbai - Maharashtra

45854188 bids are invited for sino biological 13217 hna e 200 ferritin heavy chain1 fth1 protein, human recombinant 200ug , sino biological mg50922 ut trop2 cdna orf clone, mouse untagged , eurofins unmodified sirna hplc purified 20 nmol , immoilf30cc lo

Due Date : Nov 11, 2024
Tender Value : rupee 1.77 Lakhs
View Notice
95

Local Bodies - Mumbai - Maharashtra

45770383 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Dec 20, 2024
Tender Value : Ref. Document
View Notice
96

Local Bodies - Mumbai - Maharashtra

45765848 Corrigendum : tender for supply of hplc 02 nos column (25 cm x 4.6 mm)

Due Date : Oct 31, 2024
Tender Value : rupee 3 Lakhs
View Notice
97

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

45760401 Corrigendum : bids are invited for annual maintenance contarct for high performance liquid chromatography machine annual maintenance contract for high performance liquid chromatography machine annual maintenance contract for networking devices (version 2) relevant

Due Date : Nov 12, 2024
Tender Value : Ref. Document
View Notice
98

Boards / Undertakings / PSU - nagpur - Maharashtra

45755032 tender for supply items

Due Date : Oct 25, 2024
Tender Value : Ref. Document
View Notice
99

Government Departments - Mumbai Suburban - Maharashtra

45745397 Corrigendum : bids are invited for the thermal diffusivity measurement system the thermal diffusivity measurement system concentrated solar thermal system, solar water heating system as per is 12976:1990, night vision weapon sight (thermal) weapon mounted thermal

Due Date : Dec 13, 2024
Tender Value : Ref. Document
View Notice
100

Government Departments - Mumbai - Maharashtra

45741972 bids are invited for import chemical consumables for medical research mse mak360 , primers , biotin sigma , oligo sigma , biotin labelled , sigma oligos citrate synthase activity assay kit, mitochondrial complex iii activity assay ki, oligonucleotid

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you

Tenders By City

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail