1051 Hplc tenders in Maharashtra 2024

Get latest Hplc related Tenders, online published by Bank Of Maharashtra, Cidco Maharashtra Ltd., City and Industrial Development Corporation of Maharashtra from Maharashtra state. Participate online through e-Procurement website for Hplc tenders in Maharashtra. Download Tender Documents, BOQ, Technical Bids for Hplc related Tenders from Maharashtra. Get Bidding support for etenders related to Hplc Tenders in Maharashtra. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Hplc tenders published from Maharashtra. Also get daily email alerts for Hplc related tender notices published by Government of Maharashtra.

1

Local Bodies - Mumbai - Maharashtra

45770383 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Nov 6, 2024
Tender Value : Ref. Document
View Notice
2

Local Bodies - Mumbai - Maharashtra

45765848 supply of hplc 02 nos column (25 cm x 4.6 mm) hplc 02 nos column (25 cm x 4.6 mm) 5 micron partical size hplc 01 nos column (15 cm x 4.6 mm) 5 micron partical size , medicine , hplccolumn –(25 cm x 4.6 mm) 5 micronpartical size , hplccolumn –(15 cm x 4.6 mm)5 micron partical size

Due Date : Oct 24, 2024
Tender Value : rupee 3 Lakhs
View Notice
3

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

45760401 bids are invited for annual maintenance contarct for high performance liquid chromatography machine annual maintenance contract for high performance liquid chromatography machine annual maintenance contract for networking devices (version 2) relevant hplc columns (high pressure liquid chromatography) total quantity : 1

Due Date : Nov 6, 2024
Tender Value : Ref. Document
View Notice
4

Boards / Undertakings / PSU - nagpur - Maharashtra

45755032 tender for supply items srl chemical bacterial transformation kit 2 (with blue white screening) (teaching) biolit genomic dna extraction mini kit (research) carbohydrate fermentation test kit 1 imvic test kit salmonella test kit e.coli test kit water (faecal coliform) testing kit multipurpose test kit pseudomonas test kit s. aureus test kit (pre weighed 1 kit fitc conjugation kit biochemical test kit 1 biochemical test kit ii dairy samples testing kit deoxyribonuclease 1 type 2a (from bovine p...

Due Date : Oct 25, 2024
Tender Value : Ref. Document
View Notice
5

Government Departments - Mumbai Suburban - Maharashtra

45745397 bids are invited for the thermal diffusivity measurement system the thermal diffusivity measurement system concentrated solar thermal system, solar water heating system as per is 12976:1990, night vision weapon sight (thermal) weapon mounted thermal system as per mha qrs, thermal grease, live remote temperature and humidity monitoring and alert system, thermal folder, thermal ribbon, thermal gloves, high performance liquid chromatography (hplc) system, uts thermal ticket printer (indian railway...

Due Date : Nov 29, 2024
Tender Value : Ref. Document
View Notice
6

Government Departments - Mumbai - Maharashtra

45741972 bids are invited for import chemical consumables for medical research mse mak360 , primers , biotin sigma , oligo sigma , biotin labelled , sigma oligos citrate synthase activity assay kit, mitochondrial complex iii activity assay ki, oligonucleotides hplc purified, biotin labelled oligonucleotides hplc purified, oligonucleotides hplc purified 1 10 total quantity : 1634

Due Date : Nov 5, 2024
Tender Value : Ref. Document
View Notice
7

Government Departments - goregaon - Maharashtra

45739007 supply of laboratory media, consumables, pcr kits , laboratory media, consumables, pcr kits , nutrient broth, , brillient green agar , brain heart infusion broth , rv with soya (rvs broth) , xylose lysine deoxycholate agar (xld agar) , muller kauffmann tetrathionate novobiocin (mkttn) broth , urea agar , l lysine decarboxylation medium (ldc) , tryptophan medium , kovacs reagent , sodium chloride (nacl) , macconkey agar , simmons citrate agar , barritt’s reagent a , barritt’s reagent b , buffere...

Due Date : Oct 28, 2024
Tender Value : rupee 32 Lakhs
View Notice
8

Boards / Undertakings / PSU - kolhapur - Maharashtra

45730528 annual rate contract for supply of chemical , across , alfa aesar , avra sytheesis , axiva sichem/ organic , benglore geni , eurofin , finar , filtrum fiber , fisher , hi – media , hplc , invitrogen , lancaster , loba , merck , molychem , pallav , qualigens , runa , raja chemico llp , s.d.fine , sigma aldrich , sisco research lab(srl) , b&bi , spectrochem , tci , termo fisher , thermosil fine , thomas baker , universal lab , whatman , xcelris , · the rates quoted should be inclusive of all taxe...

Due Date : Oct 29, 2024
Tender Value : rupee 87.85 Lakhs
View Notice
9

Boards / Undertakings / PSU - gadchiroli - Maharashtra

45727918 procurement of various scientific equipment under pm usha at gondwana university gadchiroli , impedance analyzer (frequency range 65120b 20hz to 120mhz frequency step size 0.1 mhz accuracy of set frequency ±0.005% ac drive level 5mv to 1vrms (varies with frequency) 100?a to 20marms (varies with frequency) measurement speeds 4 speeds selectable up to 20 measurements per second for test frequencies ?100 hz accuracy dissipation factor ±0.0005 (1+d2) quality factor ±0.05 %( q+1/q) capacitance /...

Due Date : Oct 28, 2024
Tender Value : rupee 2.39 Crore
View Notice
10

Statutory Bodies & Commissions/Committees - Nagpur - Maharashtra

45714605 bids are invited for annual indent mse acetic acid glacial, 2.5 litres , acetone, 2.5 litres , chloroform ,2.5 litres , sodium borohydride, 500 gram , water, 2.5 litres , 100 ml conical flask , pipette bulb , retort ring 9 cm diameter , reagent bottle, 2000 ml, , thermohygrometers , condensor clamp , boss head , hot air oven , muffle furnace , water bath acetic acid glacial hplc grade glacial acetic acid, tetrahydrofuran hplc grade, diethylenetriaminepenta acetic acid, hydrofluoric acid, ammoni...

Due Date : Nov 2, 2024
Tender Value : rupee 5.28 Lakhs
View Notice
11

Government Departments - Mumbai - Maharashtra

45705219 bids are invited for consumables varianttm ii b thalassemia short program pack 00 tests , biorad variant ii hplc kits a hsn code 38220090 , biorad variant ii hplc kits b hsn code 38220090 , biorad variant ii hplc kits c hsn code 38220090 , eqas hemoglobin program for variant ii hplc bio rad varianttm ii b thalassemia short program (pack: 500 tests) immunoassay reagents kits relevant multi modal intra operative nerve monitoring and consumables total quantity : 5

Due Date : Nov 2, 2024
Tender Value : rupee 5 Lakhs
View Notice
12

Local Bodies - Mumbai - Maharashtra

45677632 purchase of hplc column therapeutic drug monitoring system , item description , finpak sil / zorbax hplc c 18 column suitable for jasco ls 4000 series / surveyour lc series 250mm x 4.6 mm x 5mm

Due Date : Oct 17, 2024
Tender Value : rupee 3 Lakhs
View Notice
13

Government Departments - Mumbai Suburban - Maharashtra

45606240 bids are invited for high level instrument disinfectant high level instrument disinfectant high level medical device disinfectant, high performance power supplies, sound level meter noise level meter (sound measuring apparatus or decibel meter), digital water level recorder, high temperature steam disinfection system, telephone instrument single push button, metal shelving racks as per is 1883, high performance liquid chromatography (hplc) system high performance power supplies relevant sound l...

Due Date : Oct 29, 2024
Tender Value : Ref. Document
View Notice
14

Government Departments - Mumbai - Maharashtra

45566359 bids are invited for fraction collector and sample injector for hplc system fraction collector and sample injector for hplc system injector diagnosis and cleaning system kit for educational purpose relevant high performance liquid chromatography (hplc) system total quantity : 1

Due Date : Oct 25, 2024
Tender Value : Ref. Document
View Notice
15

Local Bodies - Aurangabad - Maharashtra

45493257 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Oct 14, 2024
Tender Value : Ref. Document
View Notice
16

Boards / Undertakings / PSU - Solapur - Maharashtra

45493256 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Oct 10, 2024
Tender Value : Ref. Document
View Notice
17

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

45489183 bids are invited for automated power backup system as per specification no. hemrltegups202401 gemarpts searched automated power backup system strings used in gemarpts portable mobile lab with power backup, online ups (v2), automated bacterial identification and susceptibility testing system, fully automatic biochemistry analyzer (v2), automated hplc system for separation of complex mixtures, solar power plant (roof top) for ongrid system, gemarpts searched three phase, robotic or automated liqu...

Due Date : Oct 29, 2024
Tender Value : Ref. Document
View Notice
18

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

45486370 bids are invited for lab chemicals for pg lab and hplc lab insert vial for hplc , levetiracetam standard , hplc coloumns s46 x150x5 micron , boldine , streptozocin insert_vial_for_hplc, levetiracetam_standard, gemarpts searched hplc_coloumns_s_46 into 150 into 5 micron, boldine, strings used in gemarpts streptozocin 1 11 total quantity : 304

Due Date : Oct 21, 2024
Tender Value : rupee 1.22 Lakhs
View Notice
19

Government Departments - Mumbai - Maharashtra

45483929 bids are invited for boq of chemicals hexane ar grade , tetrahydrofurane ar grade , tetrahydrofurane hplc grade , hydrochloric acid ar grade , triethanolamine ar grade , heptane ar grade , sodium chloride ar , karl fischer titrant , sodium dihydrogen orthophosphate hexane ar grade , tetrahydrofurane ar grade , tetrahydrofurane hplc grade , hydrochloric acid ar grade , gemarpts searched triethanolamine ar grade , heptane ar grade , sodium strings used in gemarpts chloride ar, karl fischer titran...

Due Date : Oct 21, 2024
Tender Value : Ref. Document
View Notice
20

Government Departments - Chandrapur - Maharashtra

45483628 bids are invited for automation system of diesel bowser gemarpts searched automation of diesel bowser with existing flowmeter strings used in gemarpts spirometer, water sprinkler application mounted on water gemarpts searched truck cabin truck with water tank, automated hplc result generated in gemarpts system for separation of complex mixtures relevant diesel bowser categories selected for notification total quantity : 1

Due Date : Oct 21, 2024
Tender Value : Ref. Document
View Notice
21

Boards / Undertakings / PSU - Nashik - Maharashtra

45453236 Corrigendum : bids are invited for high performance butterfly valve high performance butterfly valve 1 , high performance butterfly valve 2 , high performance butterfly valve 3 , high performance butterfly valve 4 , high performance butterfly valve 5 gemarpts searched high performance butterfly valve actuation strings used in gemarpts high performance power supplies, high performance ep lubricant (ongc), portable toilet, butterfly valve (as per api std. 609), lead acid batteries for motor vehicles with light...

Due Date : Oct 15, 2024
Tender Value : Ref. Document
View Notice
22

Government Departments - Mumbai - Maharashtra

45428280 bids are invited for consumables for medical research blue star coverslips rectangural 22x60mm thickness 0.13mm to 0.16mm , blue star coverslips square 22x22mm thickness 0.13mm to 0.16mm 10 grams each packet , blue star coverslips round 18mm thickness 0.13 mm to 0.16mm 10 grams each packet , q27605 nacl 500g , mb229 100g agarose ultrapure low eeo for molecular biology , tf 1000 1000ul universal fit filter tips clear 1000 tips per pack , as114 1l chloroform hplc grade 1litre , tcl035 10ml recom...

Due Date : Oct 17, 2024
Tender Value : rupee 2.51 Lakhs
View Notice
23

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

45421809 bids are invited for steriliser, steam, high pressure complete, 040 203 gemarpts searched steriliser, steam, high pressure complete strings used in gemarpts high pressure washer, portable fire extinguishers (v2) as per is 15683:2018, high temperature steam disinfection system, extinguisher fire defence water stored air pressure type of 9 ltrs capacity (stainless steel body), low pressure steam condensate pump (iocl), hplc gemarpts searched columns (high pressure liquid chromatography), charge r...

Due Date : Oct 17, 2024
Tender Value : Ref. Document
View Notice
24

Boards / Undertakings / PSU - nagpur - Maharashtra

45408471 tender for supply of items pure triazol reagent ssoadvanced tm universal sybr green supermix iscripttm cdna synthesis kit 0.2 ml 8 tube pcr strips without caps, low profile, optical flat 8 cap strips, ultraclear.0.2 ml, 8 cap strips hplc grade water methanol ( hplc grade) 1 octasulphonic acid sodium salt phosphoric acid sodium chloride bovin serum albumin (bsa) sodium phosphate monobasic xylene (sulphur free) glucose sucrose tris base di sodium hydrogen phosphate ethylene diaminetetraacetic acid...

Due Date : Oct 10, 2024
Tender Value : Ref. Document
View Notice
25

Boards / Undertakings / PSU - nagpur - Maharashtra

45385212 tender for supply of items c18 hplc column. pore size 5 µm. diameter: 4.6x250mm silicacolumn for waters hplc pcr workstation voltage 230 v. phase single phase. weight 10 kg. frequency 50 hz. air velocity 0.37 to 0.55 m/s. speed adjustable and dimensions 800 mm length (l) x 550 mm width (w) x 575 mm height (h) microscope filters leica microscope uv filter system a, 13 filter system, microscope objective n plan 2.5x/0.07 and objective hc pl fluotar 5x/0.15

Due Date : Oct 4, 2024
Tender Value : Ref. Document
View Notice
26

Boards / Undertakings / PSU - nagpur - Maharashtra

45385205 supply of following items, 1.. c18 hplc column 2. pcr workstation 3. microscope filters

Due Date : Oct 4, 2024
Tender Value : Ref. Document
View Notice
27

Government Departments - Amravati - Maharashtra

45384835 tender for supply of laboratory chemicals 2.4 dimitrophenyl hydrazine 24 dichloro prey acacia powder acetic acid glacial acetic unhydride acetone acetyl salicylic acid activated charonal powder agar apar alcohol ethenol alluminium hydroxide alpha napthol amaranth ammonia ammonia solution ammonium bicarbonate ammonium carbonate ammonium chloride ammonium hydroxide ammonium sulpharmate ammonium sulphate aniline anise chi arachis oil ascorbic acid bee wax yellow benedicts reagent (qualitative) b...

Due Date : Oct 5, 2024
Tender Value : Ref. Document
View Notice
28

Boards / Undertakings / PSU - Pune - Maharashtra

45362633 tender for lab chemicals; 1 iron (iii) chloride hexahydrate ar grade (fecl36h2o) mol. wt. 270.33 gm 500(250 x 2) 2 methanol hplc grade ltr 25 (2.5 x 10) 3 methanol ar grade ltr 25 (2.5x 10)

Due Date : Oct 11, 2024
Tender Value : rupee 20000.0
View Notice
29

Statutory Bodies & Commissions/Committees - Mumbai Suburban - Maharashtra

45324098 bids are invited for nc amc of telecom system at ucspl 2 11 nc amc of telecom system q1 yr1 , nc amc of telecom system q2 yr1 , nc amc of telecom system q3 yr1 , nc amc of telecom system q4 yr1 , nc amc of telecom system q1 yr2 , nc amc of telecom system q2 yr2 , nc amc of telecom system q3 yr2 , nc amc of telecom system q4 yr2 nc amc of telecom system year 1 qtr 1, nc amc of telecom system year 1 qtr 2, nc amc of telecom system gemarpts searched year 1 qtr 3, nc amc of telecom system year 1 qt...

Due Date : Sep 30, 2024
Tender Value : Ref. Document
View Notice
30

Statutory Bodies & Commissions/Committees - nagpur - Maharashtra

45319171 Corrigendum : procurement of lab solutions software for existing hplc system compatible with pda detector lc detector , procurement of labsolutions software for existing hplc system compatible with pda detector (pda) & lc detector (rf 20a) , 223 19199 51 (90279090)labsolutions lc connect cs ready (for pda detector) , 223 19199 54 (90279090)labsolutions add pda connect cs ready (for pda detector)

Due Date : Oct 16, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - YAVATMAL - Maharashtra

45297691 tender for purchase of chemicals and consumables at vngcab hostel yavatmal . sodium carbonate anhydrous sodium bicarbonate commassie brilliant blue(g250) copper (ii) sulphate pentahydrate potassium phosphate dibasic anhydrous potassium phosphate monobasic anhydrous catechol hydrogen peroxide nitroblue tetrazolium chloride (nbt) l methionine ( ) riboflavin ninhydrin, hi artm/acs sulphosalicylic acid 3% toluene, hi artm l proline acetocarmine formaldehyde sol 37 41%, hi artm chitin, flakes glyc...

Due Date : Sep 26, 2024
Tender Value : Ref. Document
View Notice
32

Government Departments - Mumbai Suburban - Maharashtra

45289767 bids are invited for p toluenesulfonyl chloride , fmoc l leucine , fmoc cys , dbi drybath incubator , hplc syringes 1710rnr , hplc syringes volume 2500 , fmoc 3 1 naphthyl , dimethyl formamide , dibromo p xylene , fmoc tranixamic acid mse total quantity : 20

Due Date : Oct 9, 2024
Tender Value : Ref. Document
View Notice
33

Boards / Undertakings / PSU - Mumbai - Maharashtra

45262613 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 2

Due Date : Oct 16, 2024
Tender Value : Ref. Document
View Notice
34

Statutory Bodies & Commissions/Committees - Raigad - Maharashtra

45251630 Corrigendum : bids are invited for supply, installation and commissioning of gas chromatograph with 06 years non comprehensive amc gemarpts searched gas chromatograph strings used in gemarpts gas burners, single burner gas range (for deep fryer), gas chromatography, blow pipe for welding and cutting as per gemarpts searched is 7653 (v2), refrigerant gas, commercial idli steamer, calibration gas, gas analyser, high performance liquid result generated in gemarpts chromatography (hplc) system, medical oxygen g...

Due Date : Oct 24, 2024
Tender Value : Ref. Document
View Notice
35

Boards / Undertakings / PSU - Pune - Maharashtra

45216210 tender enquiry for lab chemicals 1 isopropyl alcohol hplc grade ltr 10.0 (2.5 ltr x 04) 2 hydrochloric acid ar grade ltr 05 (2.5 ltr x 02) 3 sodium hydroxide pellets ar grade kg 02 (500 gm x 04)

Due Date : Oct 3, 2024
Tender Value : rupee 18000.0
View Notice
36

Government Departments - Gadchiroli - Maharashtra

45189715 tender for edl & ecl emergency medicine consumable & lab material lignocaine hci i.p inj 2 % 30 ml vial [1.2] topical (oint.) lignocaine 2 % 30 gm [1.4] topical lignocaine (xylocaine 4 % 30 ml vial [1.6] lignocaine with adrenaline inj 20 mg + 0.01 mg 30 ml vial [1.7] bupivacaine hydrochloride inj 0.5% 10 ml vial [2.1] bupivacaine heavy mixed with glucose solution inj 0.5% + 7.5% 4 ml amp [2.2] thiopentone sodium inj 1000 mg powder vial [3.2] ketamine hydrochloride inj 10 mg 10 ml vial [4.1] ...

Due Date : Sep 27, 2024
Tender Value : rupee 50 Lakhs
View Notice
37

Government Departments - Mumbai - Maharashtra

45179698 bids are invited for boq of chemicals dimethyl formamide hplc grade , dimethylsulphoxide gc grade , silver nitrate ar , potassium iodide ar , anisaldehyde ar , 12 cyclohexylenedinitrilotetraacetic acid ar , polysorbate 80 ar , isopropyl myristate ar , iso octane ar , ammonium dihydrogen orthophosphate ar , methanol hplc gradient grade , nylon 66 membrane filter , carbomer 934p total quantity : 333

Due Date : Oct 3, 2024
Tender Value : Ref. Document
View Notice
38

Boards / Undertakings / PSU - gadchiroli - Maharashtra

45108369 Corrigendum : supply of edl and ecl emergency medicine consumable and lab material , medicine and consumable , syp. dihydrogen sodium citrate [16.7] , lignocaine hci i.p inj 2 % 30 ml vial [1.2] , topical (oint.) lignocaine 2 % 30 gm [1.4] , topicallignocaine (xylocaine ) 4 % 30 ml vial [1.6] , lignocaine with adrenaline inj 20 mg + 0.01 mg 30 ml vial [1.7] , bupivacaine hydrochloride inj 0.5% 10 ml vial [2.1] , bupivacaine heavy mixed with glucose solution inj 0.5% + 7.5% 4 ml amp [2.2] , thiopentone sodium...

Due Date : Sep 27, 2024
Tender Value : Ref. Document
View Notice
39

Government Departments - Mumbai - Maharashtra

45096009 bids are invited for tetrahydrofuran hplc grade (q3) total quantity : 18

Due Date : Sep 20, 2024
Tender Value : rupee 25000.0
View Notice
40

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

44977976 bids are invited for automated hplc system for separation of complex mixtures (q3) ( pac only ) total quantity : 1

Due Date : Sep 23, 2024
Tender Value : Ref. Document
View Notice
41

Government Departments - Mumbai - Maharashtra

44960626 bids are invited for consumables cbc thermal paper roll size 5 5 sysmex , tarsons micro pipette tips 200 1000 aul per pack size 500 nos , cedar wood oil 5ml , sodium hypochlorite 4percent pack size 5 lit , eqas hemoglobin program for variant ii hplc bio rad , hplc register 300 pages icmr crmch niih total quantity : 73

Due Date : Sep 20, 2024
Tender Value : Ref. Document
View Notice
42

Boards / Undertakings / PSU - Mumbai Suburban - Maharashtra

44946000 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 2

Due Date : Oct 5, 2024
Tender Value : Ref. Document
View Notice
43

Government Departments - Mumbai Suburban - Maharashtra

44861101 bids are invited for hplc columns (high pressure liquid chromatography) (q3) mse total quantity : 8

Due Date : Sep 2, 2024
Tender Value : Ref. Document
View Notice
44

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

44858053 tender for supply of hplc and gc columns at central drugs testing laboratory, mumbai. 4.6 mm x 15 cm, 3um packed with aminopropylsilane chemically bonded to totally porous silica gel support specification: ph range: 2 to 7 or better temperature limit: not less than 50°c pore size: not more than 100a° surface area minimum 200 m²/g 15 cm x 4.6 mm, 5um packed with polyamine chemically bonded to cross linked polyvinyl alcohol polymer specification: ph range: 2 to 9 or better temperature limit: no...

Due Date : Sep 17, 2024
Tender Value : Ref. Document
View Notice
45

Government Departments - nashik - Maharashtra

44767162 Corrigendum : performing lab investigations esis hospital satpur, nashik 1 urine routine ph, specific gravity, sugar, protein andmicroscopy 2 urine microalbumin 3 stool routine 4 stool occult blood 5 post coital smear examination 6 semen analysis 7 haemoglobin (hb) 8 total leucocytic count (tlc) 9 differential leucocytic count (dlc) 10 erythrocyte sedimentation rate (esr) 11 total red cell count with mcv,mch,mchc,drw 12 complete haemogram/cbc, hb,rbc count and indices,tlc, dlc, platelet, esr, ...

Due Date : Sep 5, 2024
Tender Value : Ref. Document
View Notice
46

Government Departments - Mumbai - Maharashtra

44737024 bids are invited for bid for hplc column c18 hplc column 15 cm x 4.6x 5um , c18 hplc column 15 cm x 4.6x 3um , c18 hplc column cm x 4.6x 5um , c18 hplc column 5 cm x 4.6x 3um , c8 hplc column 15 cm x 4.6x 3um total quantity : 10

Due Date : Sep 16, 2024
Tender Value : rupee 5 Lakhs
View Notice
47

Boards / Undertakings / PSU - Mumbai - Maharashtra

44729994 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 6

Due Date : Sep 23, 2024
Tender Value : Ref. Document
View Notice
48

Statutory Bodies & Commissions/Committees - chandrapur - Maharashtra

44711930 Corrigendum : tender for emergency equipment and instrument 1 300m.a. x ray machine 2 4 multipara monitors (nibp, spo2, ecg, puise) 3 acrycic starlization box 4 acrycic starlization tray 5 acrylic bucket for medicine transport 6 auto clave (vertical) for bmw sterlization 7 auto clave hp (horizontal) 4 drums 1500x600x900 8 baby radient warmer 9 bera machine 10 bio medical waste bags(all colour) medium size 11 bio medical waste bins large size 12 bio medical waste pucture proof container 13 bio ...

Due Date : Sep 6, 2024
Tender Value : Ref. Document
View Notice
49

Government Departments - Thane - Maharashtra

44635510 Corrigendum : bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Aug 31, 2024
Tender Value : rupee 1.80 Lakhs
View Notice
50

Government Departments - Mumbai - Maharashtra

44607216 bids are invited for supply of chemicals and tlc plate triethyamine hplc grade , glacial acetic acid ar grade , tartaric acid ar grade , pentane 1 sulfonic acid , dicyclohexylamine ar , ferric chloride ar , chlorobenzene gc grade , buffer solution ph 4 , buffer solution ph 7 , buffer solution ph 9 , buffer solution ph 10 , perchloric acid ar , methanol hplc , tlc plate silica gel hf 254 , phosphorous pentaoxide ar total quantity : 305

Due Date : Aug 28, 2024
Tender Value : rupee 5.15 Lakhs
View Notice
51

Government Departments - Mumbai - Maharashtra

44589888 bids are invited for consumables primer hplc purifications 100 nm make eurofins , eosin 5 maleimide dye , genescan 500 liz size std , glucose 6 phosphate dehydrogenase from baker s yeast s cerevisiae , l lactic dehydrogenase form rabbit muscle , phospho enol pyruvate , microamptm 48 well optical adhesive film , dna molecular weight marker viii total quantity : 1007

Due Date : Aug 28, 2024
Tender Value : Ref. Document
View Notice
52

Statutory Bodies & Commissions/Committees - Mumbai Suburban - Maharashtra

44413914 Corrigendum : bids are invited for chromatography 90.00.00.486.9 high perf liquid chrom sys , 90.00.00.48.9 man spr for hplc , 90.00.00.488.9 cons spr for hplc , instln comm and trainining of hplc , 1st yr amc aft std wart of hplc , 2nd yr amc aft std wart of hplc , 3rd yr amc aft std wart of hplc crfq no 1000421272 high performance liquid total quantity : 7

Due Date : Sep 4, 2024
Tender Value : rupee 57.90 Lakhs
View Notice
53

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

44408128 bids are invited for acetone ar grade 2.5 ltr , toluene ar grade 2.5 ltr , hplc water 1 ltr , iso propyl alcohol ar grade 2.5 ltr , karl fisher reagent pckt (2 x 250 ml) , methanol hplc grade 2.5 ltr , methanol specially dried for kf ar grade 500 ml , methanol lr grade 2.5 ltr , tetrahydrofuran 1 ltr , formaldehyde solution 500 ml , ethyl acetate 2.5 ltr , carbon tetrachloride ar grade 2.5 ltr , isobutanol lr grade 25 ltr , petroleum benzene 2.5 ltr , buffer capsules ph 4.0+ 0.05 , buffer cap...

Due Date : Aug 16, 2024
Tender Value : Ref. Document
View Notice
54

Statutory Bodies & Commissions/Committees - Pune - Maharashtra

44408102 bids are invited for high performance liquid chromatography (hplc) system as per specifcaiton total quantity : 1

Due Date : Aug 19, 2024
Tender Value : Ref. Document
View Notice
55

Government Departments - Mumbai - Maharashtra

44395394 bids are invited for qiagen products 330231 , 330401 , 330524 , 200336 , ermec591 , 327743 , 81223 , 429252 , 650463 , a3678 , slhar33ss , d2650 , biotin hplc purified , oligo hplc purified , b6916 import chemical consumables for medical research sigma total quantity : 597

Due Date : Aug 16, 2024
Tender Value : Ref. Document
View Notice
56

Government Departments - Pune - Maharashtra

44395181 bids are invited for albumine bovine fraction v for molecular biology as per boq specifications , coenzyme a free acid extrapure as per boq specifications , r d lactate dehydrogenase as per boq specifications , hepes buffer as per boq specifications , pyruvate kinase as per boq specifications , tes buffer sodium salt extrapure as per boq specifications , beta nad dot na as per boq specifications , beta nadh as per boq specifications , beta nadp k as per boq specifications , be...

Due Date : Aug 16, 2024
Tender Value : Ref. Document
View Notice
57

Government Departments - Mumbai Suburban - Maharashtra

44373013 bids are invited for luteolin as a primary reference standard for hplc analysis mse total quantity : 50

Due Date : Aug 23, 2024
Tender Value : Ref. Document
View Notice
58

Government Departments - Mumbai - Maharashtra

44334774 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 1

Due Date : Aug 21, 2024
Tender Value : rupee 50000.0
View Notice
59

Government Departments - Mumbai - Maharashtra

44331250 Corrigendum : bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 2

Due Date : Aug 23, 2024
Tender Value : rupee 1 Lakhs
View Notice
60

Government Departments - Mumbai - Maharashtra

44331187 Corrigendum : bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 2

Due Date : Aug 23, 2024
Tender Value : rupee 2 Lakhs
View Notice
61

Government Departments - Mumbai - Maharashtra

44325431 bids are invited for consumables pbs ph 7.4 500ml , n hydroxysulfosuccinimide sodium salt hplc , 2 morpholinoethanesulfonic acid monohydrate buffer substance mes , 1 methyl 2 pyrrolidinone cas number 872 50 4 328634 1l , polyethylene glycol sorbitan monolaurate tween 20 , whatman quantitative filter paper ashless grade 40 circles diam. 110 mm pack of 100 , piercea protein concentrator pes 10k mwco 5 20 ml , tarsons 15 ml graduated centrifuge tube pp 546021 25 pcs or pack , tarsons 50ml centrif...

Due Date : Aug 13, 2024
Tender Value : Ref. Document
View Notice
62

Government Departments - rasayani - Maharashtra

44309771 tender for annual maintenance contract for various machines.; 01. annual maintenance contract balance metler toledo me 204 1 amc balance qty. 2 nos. 02. annual maintenance contract systronics spectrophotometer 2 amc visiscan spectro model no. 167 qty. 2 nos. 03. annual maintenance contract hplc younglin make 3 amc hplc model 9100.

Due Date : Aug 9, 2024
Tender Value : Ref. Document
View Notice
63

Government Departments - Rasayani - Maharashtra

44308614 tender for annual maintenance contract balance metler toledo me 204 1 amc balance qty. 2 nos 02. amc systronics spectrophotometer 2 amc visiscan spectro model no. 167 qty. 2 nos. 03. amc hplc younglin make 3 amc hplc model 9100.

Due Date : Aug 9, 2024
Tender Value : Ref. Document
View Notice
64

Government Departments - Mumbai - Maharashtra

44287852 Corrigendum : bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 6

Due Date : Aug 12, 2024
Tender Value : rupee 2.50 Lakhs
View Notice
65

Boards / Undertakings / PSU - Mumbai Suburban - Maharashtra

44209083 Corrigendum : bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 6

Due Date : Aug 13, 2024
Tender Value : Ref. Document
View Notice
66

Boards / Undertakings / PSU - mumbai - Maharashtra

44131107 tender for peptide synthesizer hplc pump

Due Date : Jul 22, 2024
Tender Value : rupee 6.91 Lakhs
View Notice
67

Boards / Undertakings / PSU - akola - Maharashtra

44105220 tender for plastic fencing net and analytical services of gc ms, gc, hplc and icp oes

Due Date : Jul 15, 2024
Tender Value : Ref. Document
View Notice
68

Government Departments - Aurangabad - Maharashtra

44102257 Corrigendum : purchase of lab chemicals, indicators and glassware, filter papers, plastic wares etc. at food and drug administration laboratory chhatrapati sambhajinagar , chemicals / indicators (la/ar/hplc/gr) , culture media indicators , filter papers , glasswares , consumables / columns / accessories , nabl certified chemicals, indicators, glasswares , plastic wares , note for details please refer tender documents

Due Date : Aug 5, 2024
Tender Value : rupee 25 Lakhs
View Notice
69

Government Departments - MUMBAI - Maharashtra

44041462 bids are invited for annual maintenance contract hplc, quaternary high performance liquid chromatography (hplc) model no yl 9100 total quantity : 1

Due Date : Jul 25, 2024
Tender Value : Ref. Document
View Notice
70

Boards / Undertakings / PSU - Mumbai Suburban - Maharashtra

44032842 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 6

Due Date : Jul 25, 2024
Tender Value : Ref. Document
View Notice
71

Local Bodies - Mumbai - Maharashtra

44031026 Corrigendum : the purchase of chemicals required for therapeatic drug monitoring system , methanol hplc grade 2.5 lit , 2 propanol ( 1l ) hplc grade , toluene ( 1l ) hplc grade , dimethly sulfoxide for analysis acs (dmso) ( pack of 500 ml each ) , ethanol suitable for hplc ( pack of 500 ml each ) , glacial acetic acid ( 1l ) hplc grade , ethly acetate ( 1l ) hplc grade

Due Date : Jul 22, 2024
Tender Value : rupee 2.50 Lakhs
View Notice
72

Government Departments - Mumbai - Maharashtra

44025625 bids are invited for purchase of chemicals and allied items petroleum ether 80 ar grade , n methyl 2 pyrrolidone gc grade , n methyl 2 pyrrolidone hplc grade , dioctyl sodium sulphosuccinate , orthophosphoric acid ar grade , sodium hydrogen sulphate monohydrate ar grade , cupric nitrate trihydrate ar grade , triton x 100 ar grade , 4 chlorobenzoic acid ar grade , trifluoroacetic acid ar , dibutylamine ar , 1heptanesulphonic acid sodium salt ar , fluorescamine ar , copper standards for aas 1000 ...

Due Date : Jul 25, 2024
Tender Value : Ref. Document
View Notice
73

Government Departments - Mumbai Suburban - Maharashtra

44006481 bids are invited for isg15 amc gross quantity: pack of 50 μ gross quantity: pack of 50 μg purity: ≥ purity: ≥95% hplc 95% hplc 95% hplc aliquoting to: 1(vials) aliquoting to: 1(vials) delivery form: lyophilized total quantity : 9

Due Date : Jul 24, 2024
Tender Value : Ref. Document
View Notice
74

Government Departments - Mumbai Suburban - Maharashtra

43921657 bids are invited for hesperetin? 95.0% (hplc) vial containing 50g, aebsf hydrochloride 1 vial containing 1g mse total quantity : 1

Due Date : Jul 19, 2024
Tender Value : Ref. Document
View Notice
75

Government Departments - Mumbai - Maharashtra

43873699 bids are invited for consumables for medical research thermo sigma primer for qrdr gyraf5cgtcgtgttctttatggtgc3 20mer , primer for qrdr 20mer , primer for qrdr parcf5tgggcttaaaacccaccact3 20mer , primer for qrdr parcr5cgggtttctgtgtaacgcat3 20mer , q32880 qubit microrna assay kit , e6909 ecm gel from engelbroth holm sworm murine sarcoma 5ml , m5655 500mg thiazolyl blue tetrazolium bromide mtt , r8755 rpmi 1640 medium 10x1l , sml 0868 5ml purmorphamine , xnat2 1kt extract n amp tissue pcr kit 100...

Due Date : Jul 17, 2024
Tender Value : rupee 4.16 Lakhs
View Notice
76

Government Departments - Mumbai - Maharashtra

43662140 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 1

Due Date : Jul 5, 2024
Tender Value : Ref. Document
View Notice
77

Government Departments - Mumbai - Maharashtra

43662027 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 3

Due Date : Jul 4, 2024
Tender Value : rupee 1 Lakhs
View Notice
78

Government Departments - Mumbai - Maharashtra

43650653 Corrigendum : bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 2

Due Date : Jul 4, 2024
Tender Value : rupee 1.50 Lakhs
View Notice
79

Government Departments - Mumbai - Maharashtra

43626846 Corrigendum : bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 3

Due Date : Jul 4, 2024
Tender Value : rupee 2 Lakhs
View Notice
80

Local Bodies - Mumbai - Maharashtra

43625968 purchase of hplc column required for therapeutic drug monitoring purchase of hplc column , part a , hplc column suitable for jasco ls 4000 series c 18 (250mm x4.6mm x 5um)

Due Date : Jun 18, 2024
Tender Value : rupee 2.90 Lakhs
View Notice
81

Local Bodies - Mumbai - Maharashtra

43625750 Corrigendum : purchase of acetonitrile hplc grade for chromatography purchase of acetonitrile for chromatography of hplc grade (pack of 2.5 ltr.) , part a , acetonitrile for chromatography hplc grade (pack of 2.5 ltr.)

Due Date : Jul 2, 2024
Tender Value : rupee 2.50 Lakhs
View Notice
82

Government Departments - Mumbai Suburban - Maharashtra

43564907 bids are invited for fatty acids even carbon straight chains, individually packed, analytical standard hplc, gc suitable , fatty acid methyl esters, saturated, individually packed, analytical standard hplc, gc suitable mse total quantity : 2

Due Date : Jun 27, 2024
Tender Value : Ref. Document
View Notice
83

Government Departments - Mumbai - Maharashtra

43537192 bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 6

Due Date : Jun 24, 2024
Tender Value : rupee 3 Lakhs
View Notice
84

Boards / Undertakings / PSU - Pune - Maharashtra

43530812 tender enquiry for lab chemicals; 1) methanol hplc grade = 25 ltr 2) acetone ar grade = 10 ltr 3) hydrochloric acid ar grade = 5 ltr 4) isopropyl alcohol ar grade = 2.5 ltr

Due Date : Jun 21, 2024
Tender Value : rupee 30000.0
View Notice
85

Government Departments - Mumbai - Maharashtra

43510739 Corrigendum : tender for cmc for lcms 6550 qtof system (qty: 1 nos.); comprehensive maintenance contract (cmc) for hrlcms qtof (high resolution liquid chromatography mass spectrometer), agilent. liquid chromatography / mass spectroscopy (lc / ms) is a technique which combines high performance liquid chromatography hplc, a powerful analytical separation technique with mass spectroscopy, a powerful analysis & detection technique. this instrument is used for analysis of an organic substance, like drugs, dyes, i...

Due Date : Jun 13, 2024
Tender Value : Ref. Document
View Notice
86

Government Departments - Raigad - Maharashtra

43504565 Corrigendum : bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 1

Due Date : Jul 20, 2024
Tender Value : Ref. Document
View Notice
87

Government Departments - Pune - Maharashtra

43488380 bids are invited for 1 sterile safety goggle hi media 1 2 hidispo bag 12 hi media 250 3 indole 3 butyric acid (iba) hi media rm385 25g 25g 1 4 1 naphthaleneacetic acid (naa) hi media grm575 25g 25g 1 5 methanol, hplc hi media as061 2.5l 2.5 lit 3 6 potassium nitrate hi media grm3946 500g 500g 10 7 calcium nitrate tetrahydrate hi media grm496 500g 500g 10 8 manganese chloride tetrahydrate hi media pct0112 500g 500g 2 9 colchicine hi media pct1302 1g 1g 1 10 indole 3 acetic acid (iaa) hi med...

Due Date : Jun 18, 2024
Tender Value : Ref. Document
View Notice
88

Government Departments - Maharashtra

43454264 auction sale of lot no: 01 lot name: hplc austic supplied by spices board cochin, gc model 8510

Due Date : May 31, 2024
Tender Value : Ref. Document
View Notice
89

Government Departments - Mumbai - Maharashtra

43432821 bids are invited for supply of laboratory chemicals and tlc plates acetone hplc grade , butyl chloride hplc grade , methanol specially dried , octane sulphonic acid sodium salt , toluene ar , sodium perchlorate monohydrate ar , dimethyl aniline ar , tetramethyl ammonium hydrogen sulphate , perchloric acid 0.1n , diethylamine ar , sodium lauryl sulphate ar , tlc plate silica gel h , tlc plate silica gel hf 254 total quantity : 89

Due Date : Jun 11, 2024
Tender Value : rupee 5 Lakhs
View Notice
90

Government Departments - Pune - Maharashtra

43426006 Corrigendum : bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 1

Due Date : Jun 15, 2024
Tender Value : rupee 1 Lakhs
View Notice
91

Government Departments - MUMBAI - Maharashtra

43390639 bids are invited for customized annual maintenance contract/cmc for pre owned products hplc; younglin; annual maintenance contract (amc); six monthly; no total quantity :

Due Date : May 30, 2024
Tender Value : rupee 2.65 Lakhs
View Notice
92

Boards / Undertakings / PSU - Pune - Maharashtra

43348848 tender enquiry for lab chemicals; 1 ) methanol hplc grade = 25 ltr 2 ) acetone ar grade = 10 ltr

Due Date : May 30, 2024
Tender Value : rupee 22000.0
View Notice
93

Government Departments - nagpur - Maharashtra

43347611 rate contract of printing of forms, registers and miscellaneous items , list of items , brown paper sheets size 39 x 39 paper gsm 80 – 90 , envelope (white) size 11.5 x 15.5 , with aiims nagpur address and logo, gsm 80 90 , envelope ct and mri printed yellow size 14.5 * 17.5 with aiims nagpur address and logo,gsm 80 90 , envelope file size (file size) size 11.5 * 15.5with aiims nagpur address and logo,gsm 80 90 , envelope laminated yellow size 8.8 * 11.9 with aiims nagpur addres...

Due Date : Jun 17, 2024
Tender Value : Ref. Document
View Notice
94

Government Departments - parel - Maharashtra

43327454 Corrigendum : supply of high performance liquid chromotograpahy ( hplc )

Due Date : May 29, 2024
Tender Value : Ref. Document
View Notice
95

Government Departments - asvini - Maharashtra

43292793 Corrigendum : procurement of 01 niv expendable medical stores for department og pathology on ote / two bid basis procurement of 01 niv expendable medical stores for department og pathology on ote / two bid basis , consumable , dual programme recorder pack ( hb hplc system )

Due Date : May 16, 2024
Tender Value : Ref. Document
View Notice
96

Government Departments - Nagpur - Maharashtra

43275976 tender for disposal of surplus/obsolete/unserviceable/condemned stores items reg. icar central citrus research institute, nagpur unserviceable lg split ac 1.5 ton (2010 model) unserviceable videocon window ac 1 ton (2010 model) unserviceable desert cooler walk in climate room humidifier cryo scientific made unserviceable room heater (bajaj made) distillation apparatus glass ms iron round pipe in different size ms iron round pipe (3 inch x 3 ft) ms iron round pipe (2 inch x 3 ft) ms iron round...

Due Date : May 15, 2024
Tender Value : Ref. Document
View Notice
97

Government Departments - Nagpur - Maharashtra

43226433 bids are invited for hplc grade chemicals mse methanol, 2.5 litre , hexane , 2.5 litre , methanolic boron trifluoride, 500 ml , selenite cystine broth twin pack , isopropyl alcohol, 2.5 litre total quantity : 86

Due Date : May 15, 2024
Tender Value : Ref. Document
View Notice
98

Government Departments - parel - Maharashtra

43220267 high performance liquid chromotograpahy ( hplc )

Due Date : May 6, 2024
Tender Value : Ref. Document
View Notice
99

Statutory Bodies & Commissions/Committees - nagpur - Maharashtra

43188116 tender for non comprehensive annual maintenance contract of hplc

Due Date : Apr 29, 2024
Tender Value : Ref. Document
View Notice
100

Government Departments - Mumbai Suburban - Maharashtra

43092418 bids are invited for high performance liquid chromatography ( hplc ) analysis system ( q3 ) mse total quantity : 1

Due Date : Apr 22, 2024
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you

Tenders By City

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail