335 Hplc tenders in Madhya Pradesh 2025

Get latest Hplc related Tenders, online published by Board Of Revenue Madhya Pradesh, Board Of Secondary Education Madhya Pradesh, Central Madhya Pradesh Gramin Bank from Madhya Pradesh state. Participate online through e-Procurement website for Hplc tenders in Madhya Pradesh. Download Tender Documents, BOQ, Technical Bids for Hplc related Tenders from Madhya Pradesh. Get Bidding support for etenders related to Hplc Tenders in Madhya Pradesh. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Hplc tenders published from Madhya Pradesh. Also get daily email alerts for Hplc related tender notices published by Government of Madhya Pradesh.

1

Statutory Bodies & Commissions/Committees - Gwalior - Madhya Pradesh

47026117 bids are invited for modified oligonucleotides primer and probes ft tul4 gc 1 f aacaacccaagaaatccaacaaa 200nm hplc dry , ft tul4 gc 1 r agaggctttagcaagctctga 200nm hplc dry , ft tul4 gc 2 f acaaagtgttgataaaacaacccaa 200nm hplc dry , ft tul4 gc 2 r

Due Date : Jan 24, 2025
Tender Value : Ref. Document
View Notice
2

Cooperative - bhopal - Madhya Pradesh

46920752 supply of rp hplc machine and 1st call

Due Date : Jan 20, 2025
Tender Value : Ref. Document
View Notice
3

Cooperative - bhopal - Madhya Pradesh

46920645 tender for supply of water purification system type 1 and type 2 for lcmsms gcmsms icpms and microbiology

Due Date : Jan 20, 2025
Tender Value : Ref. Document
View Notice
4

Cooperative - bhopal - Madhya Pradesh

46920642 tender for supply of laboratory chemicals

Due Date : Jan 20, 2025
Tender Value : Ref. Document
View Notice
5

Cooperative - bhopal - Madhya Pradesh

46920640 tender for supply of laboratory glasswares

Due Date : Jan 20, 2025
Tender Value : Ref. Document
View Notice
6

Cooperative - bhopal - Madhya Pradesh

46918721 tender for supply of laboratory chemicals (list a) laboratory chemicals crm (list b). laboratory glasswares (list c), rp hplc machine item (2) water purification system (type 1 and type 2) for lcmsms.gcmsms. icpms and microbiology.

Due Date : Jan 20, 2025
Tender Value : Ref. Document
View Notice
7

Local Bodies - bhopal - Madhya Pradesh

46799911 tender for iehe bhopal invites online tender for supply of chemicals, glassware, lab articles and minor equipments

Due Date : Jan 11, 2025
Tender Value : Ref. Document
View Notice
8

Government Departments - Damoh - Madhya Pradesh

46770511 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Jan 21, 2025
Tender Value : Ref. Document
View Notice
9

Boards / Undertakings / PSU - bhopal - Madhya Pradesh

46765203 supply and installation of hplc

Due Date : Dec 27, 2024
Tender Value : rupee 40 Lakhs
View Notice
10

Local Bodies - Sagar - Madhya Pradesh

46589203 Corrigendum : bids are invited for high performance liquid chromatography (hplc) system total quantity : 1

Due Date : Jan 22, 2025
Tender Value : Ref. Document
View Notice
11

Government Departments - Bhopal - Madhya Pradesh

46380935 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) ( pac only ) total quantity : 1

Due Date : Jan 16, 2025
Tender Value : Ref. Document
View Notice
12

Boards / Undertakings / PSU - indore - Madhya Pradesh

46235152 Corrigendum : tender for e tender for molecular lab for centre of competence for sickle cell disease at maharaja yashwantrao hospital, mgm medical college, indore on turnkey basis.

Due Date : Dec 14, 2024
Tender Value : rupee 1.40 Crore
View Notice
13

Government Departments - Bhopal - Madhya Pradesh

46176960 bids are invited for acetone ar , hydrochloric acid ar , nitric acid ar , acetic acid glacial aldehyde free ar , carbon tetra chloride ar , chloroform ar , diphenyl carbazide ar , petroleum ether 40 deg 60 deg ar , petroleum ether 60 deg 80 deg ar , f

Due Date : Nov 16, 2024
Tender Value : Ref. Document
View Notice
14

Government Departments - Bhopal - Madhya Pradesh

46096468 bids are invited for automated hplc system for separation of complex mixtures (q3) ( pac only ) total quantity : 1

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
15

Government Departments - jabalpur - Madhya Pradesh

46033989 tender for hba1c reagent for hplc analyser (lifotronic gh 900 plus),hba1c control for hplc analyzer (lifotronic gh 900 plus),hba1c column for hplc analyzer (lifotronic gh 900 plus),hba1c calibrator for hplc analyzer (lifotronic gh 900 plus)

Due Date : Dec 6, 2024
Tender Value : Ref. Document
View Notice
16

Government Departments - sagar - Madhya Pradesh

45996277 Corrigendum : tender for supply of drugs consumables and surgical items in bmc sagar

Due Date : Nov 25, 2024
Tender Value : Ref. Document
View Notice
17

Government Departments - Jabalpur - Madhya Pradesh

45881438 bids are invited for phenanthroline monohydrate extra pure , sodium carbonate anhydrous acs , bismuth nitrate pentahydrate , ferrous sulphate heptahydrate pure , aluminium chloride hexahydrate extra pure ar , paraffin wax cubes , folin ciocalteus phen

Due Date : Nov 13, 2024
Tender Value : Ref. Document
View Notice
18

Cooperative - Bhopal - Madhya Pradesh

45848916 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Nov 18, 2024
Tender Value : Ref. Document
View Notice
19

Government Departments - Bhopal - Madhya Pradesh

45681462 bids are invited for ion chromatography ion chromatography ion chromatography system, spare add on battery packs for transreceiver handheld, gas chromatography, gas chromatography syringe, cordless screw driver, water for chromatography, hplc colum

Due Date : Nov 1, 2024
Tender Value : Ref. Document
View Notice
20

Government Departments - Indore - Madhya Pradesh

45659336 bids are invited for supply of portable tramp oil separator system portable tramp oil separator system portable pa system, light portable fire monitor (v2), centrifugal oil cleaning machine, portable ultrasound machine (v2), automated hplc system for

Due Date : Nov 1, 2024
Tender Value : Ref. Document
View Notice
21

Government Departments - Singrauli - Madhya Pradesh

45649089 Corrigendum : bids are invited for tank assy part no.53003 , battery mouded sch part no.427308 , c 1 by 2 nozzle with cap part no.53791 , checkfire mp elec. detect. and act. assy. part no.427312 , foray dry chemical part no.53080 , liner part no.71230 , lt 101 30

Due Date : Nov 4, 2024
Tender Value : rupee 19.54 Lakhs
View Notice
22

Statutory Bodies & Commissions/Committees - Bhopal - Madhya Pradesh

45582775 bids are invited for ftir with atr , hplc with pda detector , gel documentation system , gas chromatography with mass spectrophotometer , edxrf energy dispersive x ray fluorescence spectrometer total quantity : 5

Due Date : Oct 7, 2024
Tender Value : Ref. Document
View Notice
23

Government Departments - bhopal - Madhya Pradesh

45576949 Corrigendum : tender for calibration of medical equipment at aiims bhopal

Due Date : Nov 14, 2024
Tender Value : rupee 9 Lakhs
View Notice
24

Boards / Undertakings / PSU - indore - Madhya Pradesh

45538042 Corrigendum : e tender for molecular lab for centre of competence for sickle cell disease at maharaja yashwantrao hospital, mgm medical college, indore on turnkey basis.

Due Date : Oct 21, 2024
Tender Value : Ref. Document
View Notice
25

Government Departments - Bhopal - Madhya Pradesh

45397146 bids are invited for laboratory chemicals acetone ar , hydrochloric acid ar , nitric acid ar , acetic acid glacial aldehyde free ar , carbon tetra chloride ar , chloroform ar , diphenyl carbazide ar , petroleum ether 40 deg 60 deg ar , petroleum ether 60

Due Date : Oct 15, 2024
Tender Value : Ref. Document
View Notice
26

Government Departments - ujjain - Madhya Pradesh

44941784 Corrigendum : tender for procurement, supply, installation, commissioning, validation, documentation and qualification of equipment and instruments for cif, testing facility at mp medical devices park at vul, ujjain (tender h plastic processing assembly and packag

Due Date : Oct 8, 2024
Tender Value : rupee 7.31 Crore
View Notice
27

Government Departments - Bhopal - Madhya Pradesh

44861079 bids are invited for centrifuge with rotor for hplc (furan analysis) , mse total quantity : 1

Due Date : Sep 12, 2024
Tender Value : Ref. Document
View Notice
28

Cooperative - Bhopal - Madhya Pradesh

44857624 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Sep 13, 2024
Tender Value : Ref. Document
View Notice
29

Government Departments - Bhopal - Madhya Pradesh

44564254 Corrigendum : bids are invited for chemicals mse methanol hplc grade , methnol hplc grade , methanl hplc grade , water hplc grade , watr hplc grade total quantity : 26

Due Date : Sep 10, 2024
Tender Value : Ref. Document
View Notice
30

Statutory Bodies & Commissions/Committees - Bhopal - Madhya Pradesh

44545007 Corrigendum : bids are invited for sitc of laboratory equipment ftir with atr , hplc with pda detector , gel documentation system , gas chromatography with mass spectrophotometer , edxrf energy dispersive x ray fluorescence spectrometer total quantity : 5

Due Date : Sep 2, 2024
Tender Value : rupee 2.65 Crore
View Notice
31

Government Departments - Neemuch - Madhya Pradesh

44466715 bids are invited for supply of lab chemicals 2 propanol hplc grade 2.5 ltr , dichloromethane hplc grade 2.5 ltr , hplc grade water 1 ltr , ammonia buffer solution hplc grade 500 ml , acetone ar 2.5 ltr , heptane 1 sulphonic acid sodium salt 100 gram

Due Date : Aug 20, 2024
Tender Value : Ref. Document
View Notice
32

Statutory Bodies & Commissions/Committees - GWALIOR - Madhya Pradesh

44300360 Corrigendum : bids are invited for custom bid for services annual maintenance contract of hplc system total quantity :

Due Date : Aug 26, 2024
Tender Value : Ref. Document
View Notice
33

Statutory Bodies & Commissions/Committees - Sagar - Madhya Pradesh

44131690 Corrigendum : bids are invited for instruments at bpcl bina refinery trap big h2o 1 8in pn bmt 2 , trap big hydrocarbon 1 8in pn bht 2 , trap big o2 1 8in pn bot 2 , ignitor glow plug assy pn 19231 60680 , capillary gc column agilent pn cp7569 , hplc column analyp

Due Date : Jul 31, 2024
Tender Value : Ref. Document
View Notice
34

Cooperative - BHOPAL - Madhya Pradesh

44107725 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Jul 30, 2024
Tender Value : Ref. Document
View Notice
35

Government Departments - Bhopal - Madhya Pradesh

43776812 tender for ayush equipment

Due Date : Jul 7, 2024
Tender Value : Ref. Document
View Notice
36

Statutory Bodies & Commissions/Committees - GWALIOR - Madhya Pradesh

43754871 bids are invited for oligonuclotides and plasmids total quantity : 1948

Due Date : Jun 20, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - bhopal - Madhya Pradesh

43731188 Corrigendum : tender for rate contract of ayush equipments to be supplied and installed at pt khushilal sharma government autonomous ayurveda college and institute bhopal mp

Due Date : Jul 8, 2024
Tender Value : Ref. Document
View Notice
38

Boards / Undertakings / PSU - Jabalpur - Madhya Pradesh

43688415 e tender for supply of equipment item no. 01 high performance liquid chromatograph (hplc)with uv vis detector.

Due Date : Jun 27, 2024
Tender Value : Ref. Document
View Notice
39

Boards / Undertakings / PSU - Jabalpur - Madhya Pradesh

43685991 e tender for supply of equipment –item no. 01 high performance liquid chromatograph (hplc) with uv vis detector for strengthening of insecticide quality control testing laboratory under rkvy, govt. of mp

Due Date : Jun 27, 2024
Tender Value : Ref. Document
View Notice
40

Government Departments - Bhopal - Madhya Pradesh

43561764 bids are invited for chemicals at icar ciae plasmid isolation kit , genomic plant dna purification kit , cdna synthesis kit , taq dna polymerase from thermus aquaticus without mgcl2 , dna gel loading dye 6x , dna ladder 100 bp , t4 dna ligase 5 ul ,

Due Date : Jun 27, 2024
Tender Value : rupee 6 Lakhs
View Notice
41

Government Departments - bhopal - Madhya Pradesh

43520508 Corrigendum : tender for notice inviting proposal for annual rate contract for supply of chemicals, plastic wares, glassware, reagents and supply of gas cylinder and accessories and refilling of various gases at national forensic sciences university bhopal campus,

Due Date : Jun 25, 2024
Tender Value : Ref. Document
View Notice
42

Statutory Bodies & Commissions/Committees - GWALIOR - Madhya Pradesh

43485058 bids are invited for adenosine triphosphate atp hplc purified 98percent , t4 uusx 98percent purity nuclease free , t4 uusy 98percent purity nuclease free , t4 gp32 98percent purity nuclease free , bsu dna poi i large fragment 98percent purity nucleas

Due Date : May 30, 2024
Tender Value : Ref. Document
View Notice
43

Statutory Bodies & Commissions/Committees - Sagar - Madhya Pradesh

43411957 Corrigendum : bids are invited for software ug for agilent make hplc , software ug for agilent make simdis , software ug for agilent make gc total quantity : 4

Due Date : Jun 3, 2024
Tender Value : Ref. Document
View Notice
44

Statutory Bodies & Commissions/Committees - Gwalior - Madhya Pradesh

43402231 bids are invited for oligonuclotides and plasmids hplc or desalted oligos 10nm 11 to 40 mers , hplc or desalted oligos 25nm 11 to 40 mers , hplc or desalted oligos 25nm 41 to 60 mers , hplc or desalted oligos 200nm 100 mers above , plasmid 1 sp cas 9

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
45

Statutory Bodies & Commissions/Committees - Gwalior - Madhya Pradesh

43220532 bids are invited for molecular biology reagents for isothermal assays adenosine triphosphate atp hplc purified 98percent , t4 uusx 98percent purity nuclease free , t4 uusy 98percent purity nuclease free , t4 gp32 98percent purity nuclease free , bsu

Due Date : May 14, 2024
Tender Value : Ref. Document
View Notice
46

Statutory Bodies & Commissions/Committees - Gwalior - Madhya Pradesh

43104348 bids are invited for tetrahydrofuran hplc grade total quantity : 50

Due Date : Apr 6, 2024
Tender Value : Ref. Document
View Notice
47

Government Departments - Indore - Madhya Pradesh

43015419 bids are invited for high performance liquid chromatography (hplc) system (q3) mse total quantity : 1

Due Date : Apr 19, 2024
Tender Value : Ref. Document
View Notice
48

Cooperative - Bhopal - Madhya Pradesh

42848694 bids are invited for specification for rp hplc with pda detector. [ strictly rp hplc is needed for ghee (milk fat) analysi (q3) total quantity : 1

Due Date : Apr 3, 2024
Tender Value : Ref. Document
View Notice
49

Statutory Bodies & Commissions/Committees - Gwalior - Madhya Pradesh

42816726 Corrigendum : bids are invited for tetrahydrofuran hplc grade (q3) total quantity : 50

Due Date : Apr 2, 2024
Tender Value : Ref. Document
View Notice
50

Boards / Undertakings / PSU - Jabalpur - Madhya Pradesh

42773955 tender for supply of equipment –item no. 02 high performance liquid chromatograph (hplc) with uv vis detector for strengthening of insecticide quality control testing laboratory under rkvy, govt. of mp

Due Date : Mar 18, 2024
Tender Value : Ref. Document
View Notice
51

Boards / Undertakings / PSU - jabalpur - Madhya Pradesh

42773931 tender document (second call) supply of equipment item no. 02 high performance liquid chromatograph (hplc) with uvvis detector

Due Date : Mar 18, 2024
Tender Value : Ref. Document
View Notice
52

Statutory Bodies & Commissions/Committees - Gwalior - Madhya Pradesh

42745491 Corrigendum : bids are invited for hplc pump lc ms (q3) total quantity : 1

Due Date : Apr 8, 2024
Tender Value : Ref. Document
View Notice
53

Government Departments - JABALPUR - Madhya Pradesh

42618424 bids are invited for chemicals mse sodium metabisulphite , triethanolamine , carbopol 934 , cetrimide , polysorbate 60 , emulsifying wax pure , paraffin wax white soft pure , cetostearyl alcohol pure , methyl , propyl 4 hydroxybenzoate , methanol for hplc

Due Date : Mar 12, 2024
Tender Value : Ref. Document
View Notice
54

Statutory Bodies & Commissions/Committees - Bhopal - Madhya Pradesh

42273119 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Feb 26, 2024
Tender Value : rupee 25 Lakhs
View Notice
55

Government Departments - Jabalpur - Madhya Pradesh

42092090 bids are invited for chemicals mse methanol , water for hplc , bismuth nitrate pentahydrate , ferrous sulphate heptahydrate pure , aluminium chloride hexahydrate extra pure ar , sodium carbonate anhydrous acs , phenanthroline monohydrate extra pure ,

Due Date : Feb 19, 2024
Tender Value : Ref. Document
View Notice
56

Government Departments - Bhopal - Madhya Pradesh

42075716 bids are invited for purchase of dual labelled probes 5prime cy5 3prime bhq2 dual labelled probes 3 od page or hplc purified 1 , 5prime cy5 3prime bhq2 dual labelled probes 3 od page or hplc purified 2 , 5prime fam 3prime bhq1 dual label

Due Date : Feb 19, 2024
Tender Value : Ref. Document
View Notice
57

Government Departments - Bhopal - Madhya Pradesh

42069191 bids are invited for chemical pmcc flash point standard , certified ph buffer solution , kinematic viscosity certified eference material , hplc grade water for chromatography , koh pellets , iso propyl alcohol total quantity : 1019

Due Date : Feb 28, 2024
Tender Value : Ref. Document
View Notice
58

Statutory Bodies & Commissions/Committees - Bhopal - Madhya Pradesh

42064502 bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Feb 16, 2024
Tender Value : Ref. Document
View Notice
59

Statutory Bodies & Commissions/Committees - Bhopal - Madhya Pradesh

42014772 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Feb 15, 2024
Tender Value : Ref. Document
View Notice
60

Government Departments - jabalpur - Madhya Pradesh

41845627 tender for hba1c reagent for hplc analyzer (lifotronic gh 900 plus), hba1c column for hplc analyzer (lifotronic gh 900 plus), hba1c calibrater for hplc analyzer (lifotronic gh 900 plus) & hba1c control for hplc analyzer (lifotronic gh 900 plus)

Due Date : Feb 15, 2024
Tender Value : Ref. Document
View Notice
61

Government Departments - Bhopal - Madhya Pradesh

41489910 Corrigendum : bids are invited for high performance liquid chromatography (hplc) system (q3) ( pac only ) total quantity : 1

Due Date : Feb 12, 2024
Tender Value : rupee 45 Lakhs
View Notice
62

Boards / Undertakings / PSU - Damoh - Madhya Pradesh

41469246 bids are invited for hplc system (q3) total quantity : 1

Due Date : Jan 25, 2024
Tender Value : Ref. Document
View Notice
63

Boards / Undertakings / PSU - Jabalpur - Madhya Pradesh

41371207 Corrigendum : tender for 2nd call e tender for supply of equipment item no. 02 high performance liquid chromatograph (hplc) with uv vis detector

Due Date : Jan 29, 2024
Tender Value : Ref. Document
View Notice
64

Government Departments - jabalpur - Madhya Pradesh

41173285 tender for hba1c reagent for hplc analyzer (lifotronic gh 900 plus), hba1c column for hplc analyzer (lifotronic gh 900 plus), hba1c calibrater for hplc analyzer (lifotronic gh 900 plus) & hba1c control for hplc analyzer (lifotronic gh 900 plus)

Due Date : Jan 5, 2024
Tender Value : Ref. Document
View Notice
65

Boards / Undertakings / PSU - Bhopal - Madhya Pradesh

41121035 supply of spare parts for the existing instrument hplc system

Due Date : Dec 20, 2023
Tender Value : rupee 3.23 Lakhs
View Notice
66

Boards / Undertakings / PSU - Bhopal - Madhya Pradesh

41041005 tender for supply of semi preparative hplc

Due Date : Dec 28, 2023
Tender Value : Ref. Document
View Notice
67

Boards / Undertakings / PSU - BHOPAL - Madhya Pradesh

41008124 supply of semi preparative hplc

Due Date : Dec 28, 2023
Tender Value : rupee 25.20 Lakhs
View Notice
68

Local Bodies - Anuppur - Madhya Pradesh

41002068 bids are invited for biochemicals and reagents hplc column c18 , methanol hplc grade , acetonitrile hplc grade , isopropyl alcohol hplc grade , orthophosphoric acid 88 percent , acetic acid analytical grade for hplc , formic acid 98 er , ammonium ace

Due Date : Dec 20, 2023
Tender Value : Ref. Document
View Notice
69

Government Departments - Indore - Madhya Pradesh

40987205 Corrigendum : bids are invited for hplc system with autosampler and pda detector pump, as per the specification , degasser, as per the specification , auto sampler, as per the specification , column oven, as per the specification , detectors, as per the specificat

Due Date : Jan 8, 2024
Tender Value : Ref. Document
View Notice
70

Government Departments - Neemuch - Madhya Pradesh

40524554 Corrigendum : bids are invited for hplc columns (high pressure liquid chromatography) (q3) total quantity : 4

Due Date : Jan 27, 2024
Tender Value : Ref. Document
View Notice
71

Statutory Bodies & Commissions/Committees - SAGAR - Madhya Pradesh

40506234 Corrigendum : bids are invited for custom bid for services lump sum amount quoted for pm service for agilent make 4 gcs 1 hplc 1 shimdist and 2 reformulyzer m3 m4 for first year as per sow , custom bid for services lump sum amount quoted for breakdown service b

Due Date : Nov 27, 2023
Tender Value : Ref. Document
View Notice
72

Government Departments - Indore - Madhya Pradesh

40381473 bids are invited for high performance liquid chromatography (hplc) system (q3) mse total quantity : 1

Due Date : Nov 20, 2023
Tender Value : Ref. Document
View Notice
73

Government Departments - Neemuch - Madhya Pradesh

40370219 bids are invited for supply of misc lab items 2 propanol 2.5 ltr , chloroform 2.5 ltr , dichloromethane 2.5 ltr , hplc grade water 1 ltr , ammonia buffer solution 500 ml , acetone 2.5 ltr , heptane 1 sulphonic acid 25 gram , phosphoric acid 500 ml ,

Due Date : Nov 16, 2023
Tender Value : Ref. Document
View Notice
74

Government Departments - Neemuch - Madhya Pradesh

40320469 bids are invited for supply of misc lab items 2 propanol 2.5 ltr , chloroform 2.5 ltr , dichloromethane 2.5 ltr , hplc grade water 1 ltr , ammonia buffer solution 500 ml , acetone 2.5 ltr , heptane 1 sulphonic acid 25 gram , phosphoric acid 500 ml ,

Due Date : Nov 11, 2023
Tender Value : Ref. Document
View Notice
75

Government Departments - BHOPAL - Madhya Pradesh

40293927 bids are invited for purchase of chemicals total quantity : 493

Due Date : Oct 21, 2023
Tender Value : Ref. Document
View Notice
76

Government Departments - Damoh - Madhya Pradesh

40105672 Corrigendum : bids are invited for automated hplc system for separation of complex mixtures (q3) total quantity : 1

Due Date : Dec 27, 2023
Tender Value : Ref. Document
View Notice
77

Boards / Undertakings / PSU - Jabalpur - Madhya Pradesh

40066551 tender for supply of equipment item no. 02 high performance liquid chromatograph (hplc)

Due Date : Oct 27, 2023
Tender Value : Ref. Document
View Notice
78

Boards / Undertakings / PSU - Jabalpur - Madhya Pradesh

40039664 tender for supply of equipment – item no. 02 high performance liquid chromatograph (hplc) with uv vis detector for strengthening of insecticide quality control testing laboratory under rkvy, govt. of mp.

Due Date : Oct 27, 2023
Tender Value : Ref. Document
View Notice
79

Government Departments - Bhopal - Madhya Pradesh

39983500 bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Oct 25, 2023
Tender Value : Ref. Document
View Notice
80

Government Departments - Jabalpur - Madhya Pradesh

39796294 bids are invited for chechemicals mse flask volumetric , methanol for hplc , title 1 , title 2 , title3 total quantity : 43

Due Date : Oct 3, 2023
Tender Value : rupee 5 Lakhs
View Notice
81

Government Departments - Indore - Madhya Pradesh

39640690 Corrigendum : bids are invited for hplc columns high pressure liquid chromatography hplc columns high pressure liquid chromatography1 , hplc columns high pressure liquid chromatography2 , hplc columns high pressure liquid chromatography3 , hplc columns high pressu

Due Date : Oct 13, 2023
Tender Value : Ref. Document
View Notice
82

Government Departments - Jabalpur - Madhya Pradesh

39506259 bids are invited for laboratory chemicals mse acetonitrile , methanol for hplc , water for hplc , title 1 , title 2 total quantity : 23

Due Date : Sep 18, 2023
Tender Value : Ref. Document
View Notice
83

Boards / Undertakings / PSU - Jabalpur - Madhya Pradesh

39483233 tender for supply of equipmenthigh performance liquid chromatograph (hplc) with uv vis detector

Due Date : Sep 25, 2023
Tender Value : Ref. Document
View Notice
84

Government Departments - Indore - Madhya Pradesh

39437936 tender for software upgradation for hplc and d2 lamp

Due Date : Sep 5, 2023
Tender Value : Ref. Document
View Notice
85

Government Departments - Bhopal - Madhya Pradesh

39435323 bids are invited for acetone ar , acetic anhydride ar , acetic acid glacial aldehyde freear , ammonium molybdatear , barbituric acid , benzene ar , carbon tetra chloridear , carbon disulphidear , chloroformar , copper acetatear , diethyl etherar , fe

Due Date : Sep 4, 2023
Tender Value : Ref. Document
View Notice
86

Government Departments - ujjain - Madhya Pradesh

39356209 Corrigendum : tender for procurement, supply, installation, commissioning, validation, documentation & qualification of equipment & instruments for common infrastructure facility, testing facility at vikram udyogpuri limited, ujjain (tender a: biocompatibility microbio

Due Date : Sep 23, 2023
Tender Value : rupee 11.67 Crore
View Notice
87

Government Departments - ujjain - Madhya Pradesh

39356185 Corrigendum : tender for procurement, supply, installation, commissioning, validation, documentation & qualification of equipment & instruments for common infrastructure facility, testing facility at mp medical devices park at vikram udyogpuri limited, ujjain (tender h

Due Date : Sep 23, 2023
Tender Value : rupee 7.31 Crore
View Notice
88

Government Departments - indore - Madhya Pradesh

39313500 Corrigendum : tender for software upgradation for hplc and d2 lamp

Due Date : Sep 5, 2023
Tender Value : Ref. Document
View Notice
89

Government Departments - bhopal - Madhya Pradesh

38797729 tender for ayush equipments to be supplied & installed at pt. khushilal sharma government (autonomous) ayurveda college & institute, bhopal m.p.

Due Date : Aug 7, 2023
Tender Value : Ref. Document
View Notice
90

Government Departments - Bhopal - Madhya Pradesh

38664830 Corrigendum : bids are invited for high performance liquid chromatography (hplc) system (q3) total quantity : 1

Due Date : Aug 28, 2023
Tender Value : Ref. Document
View Notice
91

Government Departments - bhopal - Madhya Pradesh

38648394 tender for rate contract of ayush equipments to be supplied and installed at pt khushilal sharma government autonomous ayurveda college and institute bhopal mpal mp

Due Date : Aug 7, 2023
Tender Value : Ref. Document
View Notice
92

Government Departments - Bhopal - Madhya Pradesh

38579415 tender for hplc sample filteration unit

Due Date : Aug 1, 2023
Tender Value : Ref. Document
View Notice
93

Government Departments - Bhopal - Madhya Pradesh

38464624 Corrigendum : bids are invited for purchase of chemicals broth , kenknight and munaiers agar , rose bengal agar , pikovskaya agar , jensens agar , agar powder bacteriological grade , peptone , chloroform , chloroform hplc , acetone , p nitrophenyl d glucopyranosid

Due Date : Jul 24, 2023
Tender Value : Ref. Document
View Notice
94

Statutory Bodies & Commissions/Committees - Bhopal - Madhya Pradesh

38400550 bids are invited for centrifuge tubes graduated 15ml pp (q3) , centrifuge tubes graduated 50ml pp (q3) , volumetric for icpms 10mlpp class a (q3) , volumetric for icpms 100mlpp class a (q3) , volumetric for icpms25mlpp class a (q3) , volumetric for i

Due Date : Jul 19, 2023
Tender Value : Ref. Document
View Notice
95

Government Departments - Indore - Madhya Pradesh

38299351 bids are invited for hplc column hplc columns high pressure liquid chromatography total quantity : 10

Due Date : Jul 14, 2023
Tender Value : Ref. Document
View Notice
96

Statutory Bodies & Commissions/Committees - Bhopal - Madhya Pradesh

38248660 bids are invited for lab chemical acetone ar , acetic anhydride ar , acetic acid glacial aldehyde freear , ammonium molybdatear , barbituric acid , benzene ar , carbon tetra chloridear , carbon disulphidear , chloroformar , copper acetatear , diethyl ethe

Due Date : Jul 11, 2023
Tender Value : rupee 5 Lakhs
View Notice
97

Government Departments - bhopal - Madhya Pradesh

37911387 tender for laboratory equipments for chemistry

Due Date : Jun 19, 2023
Tender Value : Ref. Document
View Notice
98

Government Departments - bhopal - Madhya Pradesh

37911191 tender for laboratory equipments for biology (botany and zoology)

Due Date : Jun 19, 2023
Tender Value : Ref. Document
View Notice
99

Government Departments - jabalpur - Madhya Pradesh

37866377 tender for hba1c reagent[ including column, control, & calibrator] for hba1c (hplc) analyser (lifotronic gh 900 plus)

Due Date : May 29, 2023
Tender Value : Ref. Document
View Notice
100

Government Departments - Neemuch - Madhya Pradesh

37841090 bids are invited for misc lab items methano lcms grade 4 ltr make merck or finar or thermofisher , water hplc grade 1 ltr make merck or finar or thermofisher , syringe 2 ml , nylon syringe filter pore size 0.45um dia 13mm make thermo or rankem or epp

Due Date : Jun 15, 2023
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you

Tenders By City

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail