171 Buffers tenders in Himachal Pradesh 2025

Get latest Buffers related Tenders, online published by Central University Of Himachal Pradesh, Government Of Himachal Pradesh, Himachal Pradesh Agriculture Development Society from Himachal Pradesh state. Participate online through e-Procurement website for Buffers tenders in Himachal Pradesh. Download Tender Documents, BOQ, Technical Bids for Buffers related Tenders from Himachal Pradesh. Get Bidding support for etenders related to Buffers Tenders in Himachal Pradesh. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Buffers tenders published from Himachal Pradesh. Also get daily email alerts for Buffers related tender notices published by Government of Himachal Pradesh.

Search Result

Local Bodies - Kangra - Himachal Pradesh

48839368 bids are invited for chemicals 2 4 dichlorophenoxyacetic acid , 2 2 diphenyl 1 picrylhydrazyl , mitra medium , murashige and skoog medium , methanol , hexane , chloroform , 2 2 azino bis 3 ethylbenzothiazoline 6 sulfonic acid , rutin , chlorogenic

Due Date : May 15, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Chamba - Himachal Pradesh

48676103 bids are invited for om46 assy 46 38 holder , om46 assy 41 39b hand spike , o5340 176319 buffer (limber assy) , om46 02 38a shell retainer , lv6 mt14 2610 000024 cover outer 8.25x20 cc ply 12 , bracket (defence) total quantity : 736

Due Date : May 3, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

48623172 bids are invited for proc of spares for afvs mse lv1 r72_4720720538083_hose connection cqa hv 5 32 060 , lv1 r72_4720720538080_hose connection cqa hv 5 32 052 , lv1 r72_cqa hv 5 66 025_ pipe line assy , lv1 r72_175 11 008sb_ buffer , lv1 r72_175 3

Due Date : Apr 30, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

48570149 bids are invited for proc of spares for afvs mse lv1 r72_cqa hv 5.34.000_hose connection , lv1 r72_cqa hv 5.66.050_hose connection , lv1 r72_172.66.1333sb_hose connection , lv1 r72_172.32.544_ring packing , lv1 r72_172.32.552_gasket , lv1 r72_533

Due Date : Apr 26, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

48570072 bids are invited for proc of spares for afvs mse lv2 icvs_4720720260274 765 07 24_hose , lv2 icvs_5310 72 023 1935 700 40 258_gasket , lv2 icvs_5330720114410 700 40 257_gasket , lv2 icvs_5330720115447 765 05 432_gasket , lv2 icvs_5365010154 675 0

Due Date : Apr 26, 2025

Tender Value : Ref. Document

View Notice

Government Departments - sirmaur - Himachal Pradesh

48378796 Corrigendum : tender for notice inviting tender for manufacturing, supply and installation of library furniture at iim sirmaur

Due Date : Apr 12, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Kangra - Himachal Pradesh

48311443 Corrigendum : tender for nit for the purchase of lab reagents

Due Date : Apr 8, 2025

Tender Value :

20 Lakhs

View Notice

Government Departments - Shimla - Himachal Pradesh

47939954 Corrigendum : bids are invited for chemical alt r crispr cas9crrna , alt r crispr cas9 crrna , alt r crispr cas9crrna , alt r crispr cas9 tracr rna , alt r s.p.hifi cas9 nuclease v3 , nuclease free duplex buffer , idtx 1xte solution , portable sealed rechargeable

Due Date : Mar 28, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - palampur - Himachal Pradesh

47553219 etender for supply of chemicals consumables for 3730 dna analyser

Due Date : Feb 13, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

47324318 bids are invited for chemical alt r crispr cas9 crrna , alt r crispr cas9 crrna xt , alt r crispr cas9 tracr rna , alt r s.p. hifi cas9 nuclease v3 , nuclease free duplex buffer , idte , portable sealed rechargeable single cells nickel metal tota

Due Date : Feb 15, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

47308727 bids are invited for chemicals tae buffer 10x , topo ta cloning kit , ecori hf , bamhi hf , notl hf , sacii , rneasy plant mini kit , high capacity cdna reverse transcription kit , buffer capsules cleaning duster (v3) total quantity : 38

Due Date : Feb 14, 2025

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

47261244 bids are invited for tvrr hd 85 04.030.20.0.00 engine mounting assy of av , 0336165 cent coupling , 06.379.03.0.00 leak off pipe m14xm12 return line , c7401292 exhaust manifold , c83623008100 gear pump steering , 06.84089.02.0.00 u clamp , 50.006.10.

Due Date : Feb 8, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

47025749 Corrigendum : bids are invited for potassium dichromate (q3) , hydrochloric acid as per is 265 (q3) , potassium iodate as per is: 13057 (q3) , sodium thiosulphate as per is 14781 (q3) , buffer solutions (q3) , mercuric sulphate (q3) , ferric ammonium sulphate (q3)

Due Date : Feb 3, 2025

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Shimla - Himachal Pradesh

46866322 Corrigendum : bids are invited for spares major service kit part number 549286 02 , top nearing for oil purifier make alfa laval type mab103b 24 part number 64820 , collar for oil purifier make alfa laval type mab103b 24 part number 14166 , sleeve for oil purifier

Due Date : Jan 22, 2025

Tender Value :

5.46 Lakhs

View Notice

Government Departments - Shimla - Himachal Pradesh

46722676 Corrigendum : bids are invited for alt r crispr cas9 crrna (sbe1 g1: taatactccaaacaccaaac) , alt r crispr cas9 crrna (sbe1 g2: tcaaacatggtaatggagtg) , alt r crispr cas9 crrna (sbe1 g3: gattcgtggggctcggggtt) , alt r crispr cas9 crrna (sbe1 g4: cttgggtttacaggttctgg)

Due Date : Jan 20, 2025

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

46061396 bids are invited for alt r crispr cas9 sgrna , alt crispr cas9crrna(fla_ gl: ctaggaggtgaatctctcgt , alt rcrispr cas9crrna(fla_ g2: ttagaggtgtcacgaaa cta) , alt r crispr cas9 crrna (fla_ g3: ataacgatacagttgcaagt) , alt r crispr_ cas9 crrna (dvt_ gl: tctgtt

Due Date : Nov 30, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

45959138 bids are invited for plant dna kit 2 11 ampli taq gold 360 master mix , genomic plant dna purification kit50 , rneasy plant mini kit50 , highfidelity pcr kit200rxs , phusion high fidelity pcr kit200 rxs , tae buffer 50x 1l , qiawave plasmid mini prep

Due Date : Nov 21, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

45896725 bids are invited for chemical kits 2 12 bigdye tm terminator v3.1 cycle sequencing kit , pop 7tm polymer for 3500 , cathode buffer container cbc , anode buffer container abc , genescan tm 500 rox tm dye size standard , amplitaq gold tm dna polymerase

Due Date : Nov 15, 2024

Tender Value :

13.40 Lakhs

View Notice

Government Departments - jubbal - Himachal Pradesh

45864385 tender for construction of reinforced cement concrete storage tank for buffer storage to counter draught at village sundli in gp jai pidi mata in tehsil jubbal distt shimla hp sh construction of reinforced cement concrete s/tank of 80000 ltrs cap at

Due Date : Nov 1, 2024

Tender Value :

7.52 Lakhs

View Notice

Government Departments - jubbal - Himachal Pradesh

45631542 tender for construction of reinforced cement concrete storage tank for buffer storage to counter draught at village sundli in gp jai pidi mata in tehsil jubbal distt shimla hp sh construction of reinforced cement concrete s tank of 80000 ltrs cap at

Due Date : Oct 18, 2024

Tender Value :

7.52 Lakhs

View Notice

Government Departments - Shimla - Himachal Pradesh

45540154 bids are invited for alt r crispr cas9 sgrna , alt r crispr cas9 crrna (fla_ g1: ctaggaggtgaatctctcgt) , alt r crispr cas9 crrna (fla_ g2: ttagaggtgtcacgaaacta) , alt r crispr cas9 crrna (fla_ g3: ataacgatacagttgcaagt) , alt r crispr cas9 crrna (dvt_ g1:

Due Date : Oct 24, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

45483372 bids are invited for ampicillin sodium salt 25gm , kanamycin sulfate 5g , ta cloning kit 20rxs , datp(100mm) 250ul , pcr cloning kit (20rxs) , rcut smart buffer (conc. 10x) 5ml , ecorl (size 10000 units) , bamhl( size 10000 units) , notl (size:

Due Date : Oct 21, 2024

Tender Value : Ref. Document

View Notice

Government Departments - shimla - Himachal Pradesh

45311667 tender for national hydrology project sh supply of kits crm chemicals and glassware for district water testing lab dhalli shimla

Due Date : Sep 27, 2024

Tender Value :

6.96 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

45280194 bids are invited for bids are invited for clip frame d gasket gasket gasket gasket gasket strap clip packing sheet absorber shock absorber shock gasket gasket gasket ring packing buffer ring packing gasket ring gasket ring gasket r

Due Date : Sep 19, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - palampur - Himachal Pradesh

45150997 Corrigendum : tender for up gradation of tissue culture lab puff panelling work

Due Date : Sep 26, 2024

Tender Value :

9.63 Lakhs

View Notice

Government Departments - Shimla - Himachal Pradesh

45049365 bids are invited for tris acetate edta buffer 50x , sodium hypochlorite solution (4 6% ) lab grade i total quantity : 9

Due Date : Sep 26, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

45049361 Corrigendum : bids are invited for ethanol membrane for ysi , ethanol standards kit , carbonate buffer concentrate for ysi total quantity : 3

Due Date : Oct 3, 2024

Tender Value :

1 Lakhs

View Notice

Boards / Undertakings / PSU - Shimla - Himachal Pradesh

44531291 Corrigendum : bids are invited for shimla mse emergency light , landing door guide shoe , coated steel belt , car top sheave car guide shoe gips , pcb bcb gen 2 aro , air cord , power supply , handrail sheave , escalator stop key panel , buffer ring , pcb gcsecb 5

Due Date : Sep 10, 2024

Tender Value :

1.09 Crore

View Notice

Government Departments - shimla - Himachal Pradesh

44525768 tender for supply of kits, crm, chemicals and glassware for district water testing lab dhalli, shimla

Due Date : Aug 21, 2024

Tender Value :

6.96 Lakhs

View Notice

Government Departments - Shimla - Himachal Pradesh

44450835 bids are invited for ethanol membrane , ethanol standards kit , carbonate buffer con. mse total quantity : 3

Due Date : Aug 20, 2024

Tender Value : Ref. Document

View Notice

Government Departments - shimla - Himachal Pradesh

44424587 Corrigendum : rate contract for the supply of allopathic veterinary medicines, veterinary feed supplements, chemicals, cotton, bandage and ayurvedic veterinary medicines

Due Date : Sep 12, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

44325052 bids are invited for sucrose calibrator , dextrose lactate calibrator , glucose membrane , sucrose membrane , buffer for glucose, l lactate, dextrose, sucrose, glutamate, chlorine chemistries total quantity : 18

Due Date : Aug 13, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

44174672 bids are invited for procurement of spares for afvs total quantity : 798

Due Date : Jul 13, 2024

Tender Value : Ref. Document

View Notice

Government Departments - kangra - Himachal Pradesh

44085126 construction of school of nursing at dr.rpgmc kangra at tanda in distt. kangra, hp (sh providing it equipments therein)

Due Date : Jul 15, 2024

Tender Value :

12.10 Lakhs

View Notice

Government Departments - Solan - Himachal Pradesh

43835342 bids are invited for chemical and glassware dna elution buffer tris ci ph 8.5 10mm250 ml , agarose special low eeo of 500g , 10x tbe buffer for agarose gel electrophoresis , ehtidium bromide solution 10mg ml of 10ml , n hexane 2.5 liter details see p

Due Date : Jul 15, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

43661729 Corrigendum : bids are invited for proc of spares for afvs lv1 r72_175 33 328_gasket , lv1 r72_175 33 329_gasket , lv1 r72_150 31 2170_ring buffer , lv1 r72_175 33 525 1_gasket , lv1 r72_520 10 004 16_gasket 21x200 , lv1 r72_54 065 066 1_gasket , lv1 r72_188

Due Date : Jul 5, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

43619793 bids are invited for proc of spares for afvs mse lv1 r72_mn4152 62_packing ring 12x16 , lv1 r72_175 33 328_gasket , lv1 r72_175 33 329_gasket , lv1 r72_150 31 2170_ring buffer , lv1 r72_175 33 525 1_gasket , lv1 r72_520 10 004 16_gasket 21x200 ,

Due Date : Jul 2, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

43411056 bids are invited for procurement of afvs spares 1 hose 8mm 2 hose 10mm 3 hose 16mm 4 packing ring 12x16 5 packing ring 33x39 6 packing ring 30x36 7 packing ring 18x24 8 gasket 9 fuse sp 5 10 fuse cp 20 11 fuse cp 2 12 fuse tp 400 13 rubber boo

Due Date : Jun 7, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Shimla - Himachal Pradesh

43149926 Corrigendum : bids are invited for supply of loctout tagout items for njhps equipment (q3) vinyl coated hasp small red de electric slider hasp for 4 lock 3hole 45 mm clearance squeezer multipurpose cable lockout metallic blue cable electrical panel lockout

Due Date : May 8, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - kangra - Himachal Pradesh

42907444 e tender reagents and chemical

Due Date : Apr 10, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mandi - Himachal Pradesh

42599363 bids are invited for ammonium oxalate , amonia solution , barium chloride , buffer ph 9.2 , ethlene diamino tatraceticacid , hydrochloric acid , methyl orange , methyl red , magnesium chloride , magnesium sulphate , potassium chloride , pot

Due Date : Mar 4, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Solan - Himachal Pradesh

42117523 bids are invited for chemical and glasware b glucan assay kit yeast and mushroom , total dietary fiber assay kit , cordycepin , adenosine , ganoderic acid a , l methionine 1x25 grams , riboflavin 1x25 gram , tannic acid 1x100 gram , folin and ciocalt

Due Date : Feb 22, 2024

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Mandi - Himachal Pradesh

42072569 bids are invited for ammonium oxalate , amonia solution , barium chloride , buffer ph 9.2 , ethlene diamino tatraceticacid , hydrochloric acid , methyl orange , methyl red , magnesium chloride , magnesium sulphate , potassium chloride , potassium per

Due Date : Feb 19, 2024

Tender Value : Ref. Document

View Notice

Local Bodies - KANGRA - Himachal Pradesh

42061455 bids are invited for chemicals lithium manganese oxide , n methyl 2 pyrrolidone , activated charcoal hard carbon , lithium hexafluorophosphate , ethylene carbonate , ethylene methyl carbonate , dimethyl carbonate , dimethyl sulfoxide , ph buffer solution

Due Date : Feb 20, 2024

Tender Value :

2.50 Lakhs

View Notice

Government Departments - Hamirpur - Himachal Pradesh

41826619 tender for supply and set up of laboratory equipment’s, chemicals and glassware/plastic ware for environmental science laboratory in academic block of hptu.

Due Date : Feb 8, 2024

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

41534820 bids are invited for buffer spring buffer spring , front hand grip accessory , tool removing butt accessory , ramp accessory , rubber bush total quantity : 855

Due Date : Jan 19, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

41427180 bids are invited for pop 7 (96) polymer 3500 series (q3) , andoe buffer container 3500 series (q3) , cathode buffer container 3500 series (q3) , hi di formamide (q3) , ampli taq gold 250u (q3) , 3500 genetic analyzer 8 capillary array, 50cm (q3) tota

Due Date : Jan 5, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

41406166 bids are invited for sucrose calibrator (q3) , dextroselactate calibrator (q3) , glucose membranes (q3) , sucrose membranes (q3) , buffer for glucose (q3) , nacl solution (q3) mse total quantity : 9

Due Date : Jan 24, 2024

Tender Value : Ref. Document

View Notice

Government Departments - Solan - Himachal Pradesh

41099724 bids are invited for chemical sulphuric acid sp gr 1.84 , sodium hydroxide , potasium sulphate , copper sulphate , boric acid , selenium metaql powder , bromocresol green indicator , ar grade methyle red indicator , ph buffer 4.0 , ph buffer 7.0 , ph

Due Date : Dec 25, 2023

Tender Value : Ref. Document

View Notice

Government Departments - kangra - Himachal Pradesh

40930228 Corrigendum : tender for supply ofmaterial, design, erection, testing, commissioning, forshifting/rerouting of various h.t/ l.t. lines at different locations to dispose off the various public representations recommended through honble mla of nagrota bagwan constituenc

Due Date : Dec 22, 2023

Tender Value :

8.04 Lakhs

View Notice

Government Departments - kangra - Himachal Pradesh

40930215 Corrigendum : tender for supply ofmaterial, design, erection, testing, commissioning, forconstruction of complaintcumrestroom at holta under electrical division hpsebl palampur, distt. kangra

Due Date : Dec 15, 2023

Tender Value :

13.11 Lakhs

View Notice

Government Departments - Shimla - Himachal Pradesh

40750134 Corrigendum : bids are invited for sucrose calibrator (q3) , dextroselactate calibrator (q3) , glucose membranes (q3) , sucrose membranes (q3) , buffer for glucose (q3) , nacl solution (q3) total quantity : 9

Due Date : Dec 25, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

40447587 bids are invited for pop 7 (96) polymer 3500 series (q3) , andoe buffer container 3500 series (q3) , cathode buffer container 3500 series (q3) , hi di formamide (q3) , ampli taq gold 250u (q3) , 3500 genetic analyzer 8 capillary array, 50cm (q3) tota

Due Date : Nov 24, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

40273265 bids are invited for sucrose calibrator (q3) , dextroselactate calibrator (q3) , glucose membranes (q3) , sucrose membranes (q3) , buffer for glucose (q3) , nacl solution (q3) total quantity : 9

Due Date : Nov 10, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - palampur - Himachal Pradesh

39847580 etender for supply of spare parts for 3730 dna analyser

Due Date : Oct 10, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - Kangra - Himachal Pradesh

39838743 bids are invited for department of animal sciences xylene, 10 l , ethanol, 25 l , ethanol molecular grade, 5 l , paraffin wax, 10 kg , acetone, 5 l , formalin, 5 l , methanol, 5 l , methanol molecular grade, 5l , dna ladder 500 kbp, 2 pack , dna ladd

Due Date : Oct 7, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - Kangra - Himachal Pradesh

39770622 bids are invited for chemicals for department of animal sciences xylene, 10 l , ethanol, 25 l , ethanol molecular grade, 5 l , paraffin wax, 10 kg , acetone, 5 l , formalin, 5 l , methanol, 5 l , methanol molecular grade, 5l , dna ladder 500 kbp, 2 p

Due Date : Oct 3, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

39763923 bids are invited for pop 7 polymer (q3) , cathode buffer container (q3) , anode buffer container (q3) , hi di formamide (q3) , amplitaq gold dna polymerase (q3) , genetic analyzer (q3) total quantity : 10

Due Date : Oct 12, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - Kangra - Himachal Pradesh

39732908 bids are invited for chemicals agrose , ammonium acetate , ammonium per sulfate , isoamyl alcohol , boric acid , bromophenol blue , chloroform , coomassie briliant blue , ctab buffer , dna polymerase with standard taq buffer with mg2positive , dntps

Due Date : Oct 4, 2023

Tender Value : Ref. Document

View Notice

Government Departments - mandi - Himachal Pradesh

39587198 Corrigendum : tender for mz04b refurbishment of pius office

Due Date : Oct 17, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - Shahpur - Himachal Pradesh

39315921 tender for chemicals and glassware

Due Date : Sep 6, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

38655717 bids are invited for mt head wiper blade front , assy hose balancer , rubber buffer front , wiper blade assy , needle bearing , rear view mirror lh , rear view mirror rh , brake fluid container , regulator assy lh , engine mounting pad front , suspen

Due Date : Jul 26, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Bilaspur - Himachal Pradesh

38652157 bids are invited for consumable items for biochemistry department project total quantity : 70

Due Date : Jul 18, 2023

Tender Value : Ref. Document

View Notice

Government Departments - janjehli - Himachal Pradesh

38443496 construction of hppwd rest house janjehli in tehsil thunag distt. mandi hp (sh; providing & supplying of furniture, crockary & currtains and finishing items etc.)

Due Date : Jul 7, 2023

Tender Value :

29.32 Lakhs

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

38308386 bids are invited for laboratory chemicals and materials 1 46 hydrochloric acid ar , hydrochloric acid commercial , sulphuric acid ar , nitric acid ar , phenolphthalein solution indicator , methyl orange indicator , methyl red indicator , eri chrome b

Due Date : Jul 4, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - Kangra - Himachal Pradesh

38199490 bids are invited for chemicals and glassware tissue homogenizer 2 ml , beaker 100 ml , beaker 200 ml , beaker 500 ml , beaker 1000 ml , conical flask 100 ml , conical flask 200 ml , conical flask 500 ml , centrifuge tubes conical bottom one point fiv

Due Date : Jun 28, 2023

Tender Value : Ref. Document

View Notice

Government Departments - shimla - Himachal Pradesh

38101171 Corrigendum : tender for sale of unserviceable material lying in the hpseblstore/yards at katolu, undersr. executiveengineer, ganvi const division hpseb ltdjeori,disttshimla(h.p)

Due Date : Jun 19, 2023

Tender Value :

10.43 Lakhs

View Notice

Statutory Bodies & Commissions/Committees - chamba - Himachal Pradesh

37911944 tender for for the supply lab reagents and consumable items for the department of microbiology

Due Date : Jun 17, 2023

Tender Value :

15 Lakhs

View Notice

Government Departments - Bilaspur - Himachal Pradesh

37841046 bids are invited for consumable items for biochemistry department project kdm5d cdna eukariyotic expression vector , primary antibody against human kdm5d protein , primary antibody against human vimentin protein , primary antibody against human e cad

Due Date : Jun 15, 2023

Tender Value :

6.50 Lakhs

View Notice

Government Departments - sarkaghat - Himachal Pradesh

37835886 resilient and sustainable service delivery in water supply schemes in jal shakti sub division bhaderwar, division sarkaghat distt mandi hp (under jjm). (sh: site development, c/o retaining wall , brest wall ,c/o concrete weir, crated weir, recharge pit &

Due Date : Jun 3, 2023

Tender Value :

5.67 Crore

View Notice

Local Bodies - Kangra - Himachal Pradesh

37733662 bids are invited for chemicals of molecular biology agrose , ammonium acetate , ammonium per sulfate , isoamyl alcohol , boric acid , bromophenol blue , chloroform , coomassie briliant blue , ctab buffer , dna polymerase with standard taq buffer with

Due Date : Jun 2, 2023

Tender Value : Ref. Document

View Notice

Government Departments - sarkaghat - Himachal Pradesh

37629163 tender for resilient and sustainable service delivery in water supply schemes in jal shakti sub division bhaderwar, division sarkaghat distt mandi hp (under jjm). (sh: site development, c/o retaining wall , brest wall ,c/o concrete weir, crated weir, rec

Due Date : May 23, 2023

Tender Value :

5.67 Crore

View Notice

Government Departments - sarkaghat - Himachal Pradesh

37610015 tender for resilient and sustainable service delivery in water supply schemes in jal shakti sub division baldwara, division sarkaghat distt. mandi hp under jjm

Due Date : May 22, 2023

Tender Value :

4.75 Crore

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

37603073 bids are invited for chemical and lab equipements plastic wash bottle 500ml , plastic wash bottle 250ml , glass beaker 100 ml borosil , glass beaker 250 ml borosil , glass beaker 500 ml borosil , bod bottle with cover 300ml borosil , measuring cylind

Due Date : May 22, 2023

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - KANGRA - Himachal Pradesh

36752082 tender for supply of chemicals required for the ugc srg project in the department of plant science, school of life sciences, central university of himachal pradesh, academic block, shahpur, kangra (h.p.)

Due Date : Mar 20, 2023

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - KANGRA - Himachal Pradesh

36752050 quotation(s) for the supply of chemicals required for the nmpb project in the department of animal sciences, school of life sciences, central university of himachal pradesh, academic block, shahpur, kangra (h.p.)

Due Date : Mar 20, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Hamirpur - Himachal Pradesh

36696366 Corrigendum : bids are invited for microscope compound , digital balance , calcium nitrate , sucrose , potassium nitrate , ph indicator paper , measuring cylinder , thermometer , starch soluble , hcl n 10

Due Date : Mar 24, 2023

Tender Value : Ref. Document

View Notice

Local Bodies - Kangra - Himachal Pradesh

36587272 bids are invited for chemicals for environment department lithium manganese oxide , carbon black super p , carboxymethyl cellulose cmc , styrene butadiene rubber , polyvinylidene fluoride pvdf granular , n methyl 2 pyrrolidone , activated charcoal ha

Due Date : Mar 14, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Sirmaur - Himachal Pradesh

36474672 tender for resilient and sustainable services delivery in water supplies schemes under jal shakti vibhag subdivision jamta in tehsil nahan distt. sirmour hp

Due Date : Mar 4, 2023

Tender Value :

4.16 Crore

View Notice

Local Bodies - Kangra - Himachal Pradesh

36299574 bids are invited for chemicals for botany sulphate heptahydrate , manganese chloride , mercuric chloride , metaphosphoric acid , methyl jasmonate , methylene blue , millons reagent , molishs reagent, , monopotassium phosphate , ms media , mtt dimethy

Due Date : Feb 27, 2023

Tender Value : Ref. Document

View Notice

Government Departments - mandap - Himachal Pradesh

36084074 tender for resilient and sustainable service delivery in water supplies in jal shkati sub division mandap division dharampur bharari district mandi

Due Date : Feb 20, 2023

Tender Value :

4.06 Crore

View Notice

Government Departments - Solan - Himachal Pradesh

36027383 bids are invited for boqbid agar agar type 500g each , malt extract powder hi media pct0412 500g each , lithium chloride 100g mil bio grade , acid phenol 100 ml mol bio grade , cotton non absorbant 500g bundle , gloves large , glassware cleaning solu

Due Date : Feb 14, 2023

Tender Value : Ref. Document

View Notice

Government Departments - mandap - Himachal Pradesh

35813819 tender for resilient and sustainable service delivery in water supplies in jal shkati sub division mandap division dharampur bharari district mandi

Due Date : Feb 2, 2023

Tender Value : Ref. Document

View Notice

Government Departments - Shimla - Himachal Pradesh

35379443 tender for supply of other tool items, schedule no.143( annexureb)

Due Date : Jan 10, 2023

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Solan - Himachal Pradesh

34550913 tender for sulphuric acid

Due Date : Nov 7, 2022

Tender Value : Ref. Document

View Notice

Government Departments - mandap - Himachal Pradesh

34316549 tender for resilient and sustainable service delivery in water supplies in jal shkati sub division mandap division dharampur bharari district mandi

Due Date : Oct 26, 2022

Tender Value :

4.06 Crore

View Notice

Government Departments - Una - Himachal Pradesh

34102734 providing and installation of various water testing equipment etc. for sub divisional lab at amb indistt. una ( hp ) . crm grade chemicals with certificates showing traceabilityturbidity standard 10 ntubrand : merck 2 turbidity standard 100 nt

Due Date : Oct 1, 2022

Tender Value :

19.85 Lakhs

View Notice

Boards / Undertakings / PSU - Shimla - Himachal Pradesh

33750583 tender for 125 kva dg set design, manufacture, testing at works, supply, storing/forwarding to site, unloading, handling, inspection, shifting to base, installation, testing and commissioning of 125 kva prime rating radiator cooled diesel generating set

Due Date : Sep 16, 2022

Tender Value : Ref. Document

View Notice

Government Departments - shimla - Himachal Pradesh

33637518 supply installation testing commissioning and maintenance of water quality testing instruments chemicals and glasswares for testing of chemical parameters in different schools and colleges of himachal pradesh for testing of drinking water quality supply,

Due Date : Sep 7, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - kangra - Himachal Pradesh

33614168 Corrigendum : e tender of microbiology e tender for reagents and chemical for use in microbiology deptt. , scrub typhus 1gm elisa kit , respiratory syncytial virus ( rsv ) 1gm elisa kit , hepatitis delta virus 1gm elisa kit , hbeab elisa kit , toxoplasma 1gm eli

Due Date : Sep 13, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kangra - Himachal Pradesh

33447778 bids are invited for 1 5335 000891 packing preformed 2 5340 013718 ring sealing toroidal 3 5330 025020 gasket 4 rus av 8687 037 gasket 5 rus au8 683 013 gasket 6 675 71 144 gasket 7 765 71 1428 gasket 8 2590 001625 casing flexible shaft assy 9 53

Due Date : Aug 19, 2022

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - shimla - Himachal Pradesh

33439694 supply of refill assembly , hydraulic element , hydraulic filter , breather cum filter , check valve , cup line buffer .

Due Date : Aug 20, 2022

Tender Value : Ref. Document

View Notice

Government Departments - keylong - Himachal Pradesh

33303055 Corrigendum : augmentation of wss keylong town ( providing 24x7 anti freeze water supply to keylong town ) in gp keylong distt. lahual spiti ( hp ) trench weir, intake well, desilting tank, water treatment plant of 0.9 mld, buffer storage tank, rcc sectional s

Due Date : Aug 22, 2022

Tender Value :

13.11 Crore

View Notice

Government Departments - Una - Himachal Pradesh

32792096 bids are invited for ammeter , constant wire , ammeter milli , meter scale full , resistance box , sand paper , optical bench 1.5mts long , optical bench accesories , glass prism , drawing board , ammonium ferrous sulphate , lead acetate , zinc carbonate

Due Date : Jul 4, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - kangra - Himachal Pradesh

32724245 e tender e tender for reagents , scrub typhus 1gm elisa kit , respiratory syncytial virus ( rsv ) 1gm elisa kit , hepatitis delta virus 1gm elisa kit , hbeab elisa kit , toxoplasma 1gm elisa kit , anti hbs antibody elisa kit , hepatitis b antigen

Due Date : Jul 7, 2022

Tender Value : Ref. Document

View Notice

Boards / Undertakings / PSU - Kangra - Himachal Pradesh

32696276 bids are invited for wash bottle 500ml , wash bottle 250ml , beaker 100ml borosil , beaker 250ml borosil , beaker 500ml borosil , bod bottle with cover 300 ml , measuring cylinder 1000ml , measuring cylinder 500ml , measuring cylinder 250ml , measuring cy

Due Date : Jun 27, 2022

Tender Value :

5.10 Lakhs

View Notice

Boards / Undertakings / PSU - rajban - Himachal Pradesh

32648271 supply of 1. refill assembly 2. hydraulic element 3. hydraulic filter 4. breather cum filter 5. check valve 6. cup line buffer

Due Date : Jun 20, 2022

Tender Value : Ref. Document

View Notice

Statutory Bodies & Commissions/Committees - Kullu - Himachal Pradesh

32544769 bids are invited for 69126257808 oil seal , 0003382629 assy ball joint lh , 0003383429 assy ball joint rh , 269126258203 oil dam , 207599100101 pin with nylon insert for cabin , 269126208205 oil slinger , 269126253113 roller , 257689107704 rubber buffer l

Due Date : Jun 16, 2022

Tender Value : Ref. Document

View Notice

Government Departments - Mandi - Himachal Pradesh

32539150 supplying, installation testing and commissioning of 10 passenger machine room less elevator at sub tehsil building at chattri district mandi hp 1 supplying, installation, testing& commissioing of 1 no.electric traction 10passenger of standard makeco

Due Date : Jun 10, 2022

Tender Value :

21.50 Lakhs

View Notice

100

Government Departments - Mandi - Himachal Pradesh

32539133 supplying, installation testing and commissioning of 6 passenger machine room less elevator at seri culture building at balichowki district mandi hp 1 supplying, installation, testing& commissioing of 1 no.electric traction 6 passenger of standard ma

Due Date : Jun 10, 2022

Tender Value :

20.53 Lakhs

View Notice

Tenders By City

Top