1255 Reagent tenders in Chhattisgarh 2024

Get latest Reagent related Tenders, online published by Chhattisgarh Biofuel Development Authority, Chhattisgarh Environment Conservation Board, Chhattisgarh Gramin Bank from Chhattisgarh state. Participate online through e-Procurement website for Reagent tenders in Chhattisgarh. Download Tender Documents, BOQ, Technical Bids for Reagent related Tenders from Chhattisgarh. Get Bidding support for etenders related to Reagent Tenders in Chhattisgarh. Get updated with latest information & right bids related to your product & Services, We also scan local newspapers, Government websites, e-Procurement portal for Reagent tenders published from Chhattisgarh. Also get daily email alerts for Reagent related tender notices published by Government of Chhattisgarh.

1

Government Departments - raipur - Chhattisgarh

45259722 tender for purchase reagents, consumables, calibrators and controls used in equipment semi automatic coagulation analyzer (make tulip diagnostic (p) ltd. td., model hemostar xf 1.0). pt reagents liquíplastin uniplastin aptt reagents calcium chloride™ liquicelin e thrombin time reagents fibroquant control plasma plasmatrol h 1 plasmatrol h 11 plasmatrol h iii consumables hemostar xf 1.0/2.0 cuvettes

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
2

Government Departments - Raipur - Chhattisgarh

45258047 tender for to purchase reagents, consumables, calibrators and controls used in equipment hematology analyzer machine 5 part (make horiba india pvt. ltd., model abx pentra xl80). abx difftrol low abx difftrol normal abx difftrol high abx miniclean / cleaner abx lysebio abx eosinophix abx basolyse abx minoclair abx minidil lmg abx diluent abx minotrol normal abx minotrol low abx minotrol high abx difftrol normal abx difftrol low abx difftrol high

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
3

Government Departments - Raipur - Chhattisgarh

45257992 tender for to purchase reagents, consumables, calibrators and controls used in equipment hematology analyzer machine 3 part (make horiba india pvt. ltd., model abx micros es60). abx difftrol low abx difftrol normal abx difftrol high abx miniclean / cleaner abx lysebio abx eosinophix abx basolyse abx minoclair abx minidil lmg abx diluent abx minotrol normal abx minotrol low abx minotrol high abx difftrol normal abx difftrol low abx difftrol high

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
4

Government Departments - Raipur - Chhattisgarh

45257958 tender for to purchase reagents, consumables, calibrators and controls used in equipment haemodialyis machine (make b. braun medical industries, model dialog+hdf).

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
5

Government Departments - raipur - Chhattisgarh

45255640 tender for purchase reagents, consumables, calibrators and controls used in equipment nephelometer machine (make agappe diagnostic ltd., model mispa i2 mispa i2 aso test kit agappe 30 tests 1,763 12% 2 mispa i2 crp test kit agappe 30 tests 1,560 12% 3 mispa i2 rf test kit albumin alkaline phosphatase alkaline phosphatase ifcc amylase bilirubin direct bilirubin total tab calcium (arsenazo) cholesterol (s.l) ck nac creatinine enzymatic creatinine gamma gt glucose hexokinase glucose (s.l) hd...

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
6

Government Departments - raipur - Chhattisgarh

45255407 tender for purchase reagents, consumables, calibrators and controls used in equipment hplc machine (make bio rad laboratories india pvt. ltd., model d 10). hba1c kit (for d 10 hplc machine)

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
7

Government Departments - raipur - Chhattisgarh

45255322 tender for purchase reagents, consumables, calibrators and controls used in equipment fully automaticc analyzer (make agappe diagnostics ltd., model mispa clinia). albumin alkaline phosphatase alkaline phosphatase ifcc amylase bilirubin direct bilirubin total tab calcium (arsenazo) cholesterol (s.l) ck nac creatinine enzymatic creatinine gamma gt glucose hexokinase glucose (s.l) hdl c direct iron ldh p ldl c direct lipase magnesium inorganic phosphorus sgot sgpt tibc total protein triglyc...

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
8

Government Departments - raipur - Chhattisgarh

45254766 tender for purchase reagents, consumables, calibrators and controls used in equipment abg analyzer machine (make radiometer medical aps., model abl80).

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
9

Government Departments - raipur - Chhattisgarh

45254600 tender for purchase reagents, consumables, calibrators and controls used in equipment diathermy machine (make india medtronic pvt. ltd., model ft 10). ligasure small jaw sealer/divider open surgery ligasure maryland laparoscopic sealer/divider 23cm ligasure exact dissector nano coated open surgery ligasure impact instrument ligasure maryland laparoscopic sealer/divider 37cm polyhesive rem pad patient plate cautery pencil electrode 36cm lap flat l hook electrode 36cm lap wire j hook bipolar ...

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
10

Government Departments - raipur - Chhattisgarh

45254552 tender for purchase reagents, consumables, calibrators and controls used in equipment dry view laser imager (make carestream health india pvt. ltd., model dry view 6950).

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
11

Government Departments - raipur - Chhattisgarh

45254530 tender for purchase reagents, consumables, calibrators and controls used in equipment gazelle hb variant (make hemex dx, model gazelle).

Due Date : Oct 13, 2024
Tender Value : Ref. Document
View Notice
12

Government Departments - raipur - Chhattisgarh

45226684 tender for 5 year reagent rental rate contract forfully automated chemiluminescence immunoassay analyzer for department of biochemistry 1 5 years rental reagent 2 afp 3 anti tpo 4 ca 125 5 ca 19 9 6 cea 7 ckmb 8 cortisol 9 c peptide 10 ferritin 11 folate 12 rbc folate 13 total/free beta hcg 14 free psa 15 free t3 16 free t4 17 fsh 18 high sensitivity troponin i/t 19 insulin 20 intact pth 21 lh 22 papp a 23 progesterone 24 prolactin 25 testosterone 26 total hcg 27 tot...

Due Date : Oct 21, 2024
Tender Value : Ref. Document
View Notice
13

Boards / Undertakings / PSU - bastar - Chhattisgarh

45216249 tender for the supply of medicines, equipment and lab reagents and consumables suitable for the hospital.

Due Date : Sep 20, 2024
Tender Value : Ref. Document
View Notice
14

Government Departments - Raipur - Chhattisgarh

45209340 tender for procurement of consumables/ reagent to perform hpv dna test for pathology & lab medicine department of aiims raipur. digene hc2 sample conversion kit pack size 200 test 1. the reagent reagents should have a shelf life of 1 years at the time of supply hc2 high risk hpv dna test pack size 96 test 1. the reagent reagents should have a shelf life of 1 years at the time of supply xlg pipettes tips (720) pack size 720x1

Due Date : Sep 19, 2024
Tender Value : Ref. Document
View Notice
15

Government Departments - Raipur - Chhattisgarh

45207830 tender for mpo and pr3 reagent kits of biochemistry department at aiims raipur

Due Date : Sep 19, 2024
Tender Value : Ref. Document
View Notice
16

Boards / Undertakings / PSU - sipat - Chhattisgarh

45203263 procurement of fine chemicals for ntpc telangana stpp. , thorin indicator,gr , xylenol orange,c31h32n2o13s,10gm , oxalic acid,ar/gr/excelar/emparta,500gm , barium perchlorate,ar/gr/excelar/emparta , barium perchlorate,anhydrous,gr,250gm , phenol disulphonic acid,ar/gr/excelar+ , glacial acetic acid,ar , edta disodium salt,ar/gr/excelar/emparta , ammonium chloride,ar,500gm , hydrochloric acid,ar/gr/excelar/emparta , buffer solution,ammonia , sodium meta bisulphite,ar , pyrogallol,ar/gr/excelar/e...

Due Date : Sep 24, 2024
Tender Value : Ref. Document
View Notice
17

Government Departments - Raipur - Chhattisgarh

45199827 bids are invited for haematology reagents (q2) total quantity : 8700

Due Date : Sep 26, 2024
Tender Value : Ref. Document
View Notice
18

Government Departments - raipur - Chhattisgarh

45194220 supply of reagent kit for pro thrombin time pack of 05 ml (1 number=05 ml pack) reagent kit for pro thrombin time pack of 05 ml (1 number=05 ml pack), reagent kit for pro thrombin time pack of 05 ml (1 number=05 ml pack) ]

Due Date : Sep 25, 2024
Tender Value : Ref. Document
View Notice
19

Government Departments - Raipur - Chhattisgarh

45178725 tender for purchase of consumable and reagents for elisa reader cum spectrophotometer instrument for pathology and lab medicine department at aiims raipur.

Due Date : Sep 18, 2024
Tender Value : Ref. Document
View Notice
20

Boards / Undertakings / PSU - bastar - Chhattisgarh

45174092 tender for supply of medicines, medical equipments, consumables, lab reagents.

Due Date : Sep 20, 2024
Tender Value : Ref. Document
View Notice
21

Government Departments - raipur - Chhattisgarh

45153691 supply of automated capillary dna sequencer global tender inquiry for procurement of automated capillary dna sequencer for department of microbiology , automated capillary dna sequencer (specification as per section vii) , cmc of equipment1st year , cmc of equipment for 2nd year , cmc of equipment for 3rd year , cmc of equipment for 4th year , cmc of equipment for 5th year , capillary array 24 cap 50cm ruo , pop 7™ polymer for 3500 series genetic analyzers 384 samples , anode buffer container 3...

Due Date : Oct 7, 2024
Tender Value : Ref. Document
View Notice
22

Government Departments - Raipur - Chhattisgarh

45079558 bids are invited for medicines tab avil 25 mg , tab ecosprin gold , tab norflox tz , tab telma h , tab metrogyle 400 , tab aciloc 150 , tab lopramide , tab bizfer xt , tab dolonex dt 200 mg , tab sompraz 40 , tab nimoslide 100 mg , tab vertin 16 , tab itraconazole 200 mg , tab disprin 150 mg , tab sorbitrate 5 mg , tab dexona , tab albendazole 400 , sensor oil , inj cefroxime 100 mg , inj tetanus toxoid 0 point 5 mg , inj avil , derolac sachet , ors power orange flavour , electrol powder ora...

Due Date : Sep 26, 2024
Tender Value : Ref. Document
View Notice
23

Government Departments - raipur - Chhattisgarh

45072931 two year rate contract of reagents and consumables for automated immunoassay analyzer using elfa technique (to be used on vidas platform make biomerieux) at microbiology department aiims raipur. , consumable items , ige pack size : (1 x 60 tests) , procalcitonin pack size : (1 x 60 tests) , hav lgm pack size : (1 x 30 tests) , hbs ag ultra pack size : (1 x 60 tests) , anti hbs total ii pack size : (1 x 60 tests) , hbc lgm ii pack size : (1 x 30 tests) , hbe / anti hbe pack size : (1 x 30 test...

Due Date : Sep 23, 2024
Tender Value : Ref. Document
View Notice
24

Government Departments - Bilaspur - Chhattisgarh

45039327 Corrigendum : bids are invited for chemiclals glassware crms glass , evaporating dish , funnel glass , glass stirring rod , measuring cylinder , micro pipette , nessler cylinder , pipette mohr type , reagent bottle glass , reagent bottle amber , seprating funnel glass , volumetric flask glass , watch glass , beaker plastic , conical flask plastic , dropper , dropping bottle plastic , funnel holder , funnel plastic , funnel plastic , measuring cylinder plastic , volumetric flask plastic , wash bottle , alkali...

Due Date : Sep 17, 2024
Tender Value : rupee 36.04 Lakhs
View Notice
25

Government Departments - raipur - Chhattisgarh

44991610 supply of reagents for vector bench top fully automatic bio chemistry analyzer (model unicorn 230)reagents for vector bench top fully automatic bio chemistry analyzer (model unicorn 230), reagent kit for protein 200ml pack for vector bench top fully automatic bio chemistry analyzer (model unicorn 230) (1 pack= 1 number) ] , reagent kit for triglyceride 200ml pack for vector bench top fully automatic bio chemistry anal yzer (model unicorn 230) (1 pack= 1 number) ] , reagent kit for urea 200ml...

Due Date : Sep 2, 2024
Tender Value : Ref. Document
View Notice
26

Government Departments - raipur - Chhattisgarh

44991604 supply of reagents and controls for vector bench top fully automatic bio chemistry analyzer (model unicorn 230)reagents and controls for vector bench top fully automatic bio chemistry analyzer (model unicorn 230),multicalibrator 3ml pack for vector bench top fully automatic bio chemistry analyzer (model un icorn 230) (1 pack= 1 number) ] , controlnorm 2ml pack for vector bench top fully automatic bio chemistry analyzer (model unic orn 230) (1 pack= 1 number) ] , controlpath 2ml pack for vec...

Due Date : Sep 2, 2024
Tender Value : Ref. Document
View Notice
27

Government Departments - raipur - Chhattisgarh

44991591 supply of reagents for vector bench top fully automatic bio chemistry analyzer (model unicorn 230)reagents for vector bench top fully automatic bio chemistry analyzer (model unicorn 230), reagent kit for hdl cholesterol 160ml pack for vector bench top fully automatic bio chemistry analyzer (model unicorn 230) (1 pack= 1 number) ] , reagent kit for uric acid 200ml pack for vector bench top fully automatic bio chemistry analyze r (model unicorn 230) (1 pack= 1 number) ] , reagent kit for calci...

Due Date : Sep 2, 2024
Tender Value : Ref. Document
View Notice
28

Government Departments - raipur - Chhattisgarh

44959481 supply of esr analyzer on reagent rental basis for pathology and lab medicine , esr analyzer

Due Date : Sep 19, 2024
Tender Value : Ref. Document
View Notice
29

Government Departments - raipur - Chhattisgarh

44937986 tender for supply of reagent/consumables/kits/controller electrolyte analyzer, fully automated biochemistry analyzer, automated immunology analyzer, automated id/ast system, automated blood culture system, automated rna extraction system, duo prime rna extraction system, automated hematology analyzer, fully automated hematology analyzer, flow cytometer, abg machine etc.

Due Date : Sep 23, 2024
Tender Value : Ref. Document
View Notice
30

Statutory Bodies & Commissions/Committees - Bastar - Chhattisgarh

44931576 Corrigendum : bids are invited for 1 1700148643 lab regt widal card test ( box# 25 test) 2 1700148642 lab regt tbl cell pack (20 ltr.) 3 1700148641 lab regt tbl cell clean (50ml) 4 1700148640 lab regt tbl stromatolyser (500ml) 5 1700148638 med.cons micropipette tip5 50μl box#1000 6 1200003551 micro tips 100 1000ul tips for micro pip 7 2000000461 edta vial purple k3 8 1200003556 clot activator tubes any 9 2000004815 urine albumin & sugar strips pk of 100 10 1200003527 leshmanns stain reagent,any 11 17001486...

Due Date : Sep 16, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - raipur - Chhattisgarh

44846027 supply of reagent kit for glucose (god pod/hexo kinase method) pack of 10x200 ml for microlab 300 semi automated biochemistry analyzer (1 number=10x200 ml pack) reagent kit for glucose (god pod/hexo kinase method) pack of 10x200 ml for microlab 300 semi automated biochemistry analyzer (1 number=10x200 ml pack), reagent kit for glucose (god pod/hexo kinase method) pack of 10x200 ml for microlab 300 semi automated biochemistry analyzer (1 number=10x200 ml pack) ]

Due Date : Aug 28, 2024
Tender Value : Ref. Document
View Notice
32

Government Departments - Korba - Chhattisgarh

44789566 Corrigendum : bids are invited for supply of 45 different pathology lab reagents for dispensary bilirubin direct, make erba, transasia , bilirubin total, make erba, transasia , calcium, make erba, transasia , cholesterol, make erba, transasia , creatinine enzymetic, make erba, transasia , hba1c with calibrator, make erba, transasia , hba1c con low, make erba, transasia , hba1c con high, make erba, transasia , hdl cholesterol direct, make erba, transasia , uric acid, make erba, transasia ,...

Due Date : Sep 2, 2024
Tender Value : rupee 4.62 Lakhs
View Notice
33

Government Departments - raipur - Chhattisgarh

44788608 single bid notice inviting tender for rate contract for supply of consumables for abg machine siemens model rapidpoint 500 blood gas system single bid notice inviting tender for rate contract for supply of consumables for abg machine siemens model rapidpoint 500 blood gas system at aiims raipur , consumables under pac for blood gas analyser , all consumables including reagents/ cartridge/paper/electrode per samples

Due Date : Aug 29, 2024
Tender Value : Ref. Document
View Notice
34

Government Departments - raipur - Chhattisgarh

44729545 tender for procurement of reagent and consumables isoflow epics sheath fi.10l,coulter flow count 20ml, jvd, immuno trol cells, w/b control 60t, immunotrol low cell kit, 60t, optilyse c 200 tests ce, fp, flow check pro ivd 3x10ml kit, hla b 27/hla b7 fitc/pe/50t, ce, terachrome cd45 fitc/cd4 pe/cd8 ecd/cd3 pcs, 50t and clenz 5l

Due Date : Aug 21, 2024
Tender Value : Ref. Document
View Notice
35

Government Departments - Balod - Chhattisgarh

44722949 bids are invited for biology lab items preserved material of sunflower dicot stem , preserved material of maize monocot stem , preserved material of gram dicot root , preserved material of maize monocot root , cobalt chloride , small test tubes , test tube holder , biuret reagent , urease tablets , cytokinin , ethylene , blood group testing kit anti abd kit , funnel glass , beaker 100ml , beaker 250ml , beaker 500ml , conical flask 250 ml , giant eye model , specimen of liver fluke fasciola hep...

Due Date : Sep 3, 2024
Tender Value : rupee 5 Lakhs
View Notice
36

Government Departments - raipur - Chhattisgarh

44586236 fully automated chemiluminescence immunoassay analyzer with prenatal screening markers on reagent rental basis notice inviting tender for fully automated chemiluminescence immunoassay analyzer with prenatal screening markers (free of cost) on reagent rental basis per test wise for 5 years rate contract basis at department of biochemistry at aiims raipur , 5 years rental reagent , afp , anti ccp , anti tpo , ca 125 , ca 19 9 , cea , ckmb , cortisol , c peptide , ferritin , folate , free beta hcg...

Due Date : Sep 9, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - Korea - Chhattisgarh

44584583 Corrigendum : bids are invited for lab items mse test tube without rim 12 x 75 mm , cover slips 22 x 22 mm , cover slips 18 x 18 mm , tissue paper roll , sodiumm hypo chloride solution 4 persent , test tube cleaning brush small , test tube cleaning brush large , grams iodine , safranine solution , acetone , gentian violet , carbol fuchsin basic , methylene blue , sulphuric acid 20 persent , ammonia solution , sulpho salicylic acid 20 persent , sulphur powder , barium chloride , ph indicator paper universal i...

Due Date : Aug 20, 2024
Tender Value : rupee 70134.0
View Notice
38

Government Departments - Raipur - Chhattisgarh

44466213 Corrigendum : bids are invited for anti human globulin (ahg) reagent (q2) total quantity : 1800

Due Date : Sep 14, 2024
Tender Value : Ref. Document
View Notice
39

Government Departments - raipur - Chhattisgarh

44447565 rate contract for supply of reagents and consumables for flowcytometer notice inviting tender for two year rate contract for supply of reagents and consumables for flowcytometer analyzer of beckman coulter ltd. in the department of biochemistry at aiims raipur , electrical items : , quick comp 4 kit; ivd pack size: 50tests , annexin a5 fitc kit; fitc; ruo; pack size: 200tests , cd1a (human); clone: bl6; pe; ce/ivd; pack size: 100tests , cd2 (human); clone: 39c1.5; apc; asr; pack size: 1ml , cd3...

Due Date : Aug 17, 2024
Tender Value : Ref. Document
View Notice
40

Government Departments - raipur - Chhattisgarh

44429584 Corrigendum : rate contract for supply of reagents calibrators and control kits for advia centaur xp of siemens rate contract for supply of reagents calibrators and control kits for advia centaur xp of siemens for department of biochemistry at all india institute of medical sciences raipur , anemia disease state , ferritin ( fer 50t), pack size 50 tests, per pack , ferritin ( fer 250t), pack size 250tests, per pack , folic acid ( fol ba 100t), pack size 100tests, per pack , folic acid ( fol ba 500t), pack si...

Due Date : Aug 10, 2024
Tender Value : Ref. Document
View Notice
41

Boards / Undertakings / PSU - sipat - Chhattisgarh

44424339 procurement of fine chemicals for ntpc rihand , thioglycolic acid,ar/gr/excelar/emparta , iso amyl alcohol,ar/gr/excelar/emparta , toluene,ar/gr/excelar/emparta , phenol,ar/gr/excelar/emparta , hexane,ar/gr/excelar/emparta , petroleum ether,c6h14,60 80deg.c , reagent: kf appln water standard , universal indicator,500ml bottle , sodium meta bisulphite,ar , potassium hydroxide,ar/gr/excelar+ , acetone,ar , sodium hydroxide pellets,gr,500gm , oxalic acid,ar/gr/excelar/emparta , hydrochloric acid,a...

Due Date : Aug 2, 2024
Tender Value : Ref. Document
View Notice
42

Government Departments - Korba - Chhattisgarh

44414148 bids are invited for dispensary bilirubin direct , bilirubin total , calcium , cholesterol , creatinine enzymetic , hba1c with calibrator , hba1c con low , hba1c con high , hdl cholesterol direct , uric acid , total protein , erba norm , erba path , xl mutical , pm kit for em 200 , membrane for di water plan erba transasia , complete tubing kit di waqter plant erba transasia , di cartridge 10 lph erba transasia , pm kit for di water plant erba transasia , am kit for di water plant erba transas...

Due Date : Aug 5, 2024
Tender Value : rupee 4.62 Lakhs
View Notice
43

Government Departments - Korea - Chhattisgarh

44373888 bids are invited for bio chemistry analyzer uric acid 121023 , cholestrol 121021 , direct ldl120707 , direct hdl 120706 , sgpt 120617 , sgot 121216 , calcium 120262 , bilirubin 120621 , bilirubin direct 120623 , urea 121025 , creatinine 121200 , alkaline phosphate 121018 , glucose 120266 , triglyceride 121024 , xl crp 121505 , xl rf121506 , ggt 121019 , erba autowash 120958 , xl auto wash ac al 121238 , xl multical 120611 , amylase small system 121159 , fe125 121055 , uibc 125 121058 , ck mb 12...

Due Date : Aug 3, 2024
Tender Value : rupee 4.98 Lakhs
View Notice
44

Boards / Undertakings / PSU - Bhilai - Chhattisgarh

44370856 bids are invited for reagents for hmds, 1. reagent hmds initial s:0.020 0.039% 2. reagent hmds initial s:0.040 0.059% 3. : reagent hmds initial s: 0.060 0.079%. 4. reagent hmds initial sulphur >=0.08% 5. application charges total quantity : 18012

Due Date : Jul 26, 2024
Tender Value : Ref. Document
View Notice
45

Government Departments - Korba - Chhattisgarh

44331224 bids are invited for biochemistry reagent kits (q2) ( pac only ) , cardiac troponin t test kit (q3) ( pac only ) , anti a blood grouping reagent (q2) , anti b blood grouping reagent (v2) (q2) , anti d blood grouping reagent (q2) , widal test kit (q2) ( pac only ) , malaria rapid test kits (q2) total quantity : 19598

Due Date : Aug 1, 2024
Tender Value : Ref. Document
View Notice
46

Boards / Undertakings / PSU - Bastar - Chhattisgarh

44302865 Corrigendum : supply & apply of reagents along with operation & maintenance job of hmds unit in sms shop required at 3.0 mtpa integrated steel plant of m/s nsl at nagarnar, chhattisgarh

Due Date : Aug 13, 2024
Tender Value : Ref. Document
View Notice
47

Boards / Undertakings / PSU - bastar - Chhattisgarh

44248753 tender for supply of medicines, medical equipments, lab reagents, consumables.

Due Date : Aug 3, 2024
Tender Value : Ref. Document
View Notice
48

Government Departments - Balod - Chhattisgarh

44188108 bids are invited for chemistry lab atomic model set senior , melting point apparatus , boiling point apparatus thermometer , boiling test tube , small test tube , glass funnel , ph paper , blue litmus paper , red litmus paper , concentrated hcl , barium chloride , glass dropper , ammonium chloride , delivery tube , reagent bottle 250 ml , filter paper , phenophthalein , red litmus solution , blue litmus solution , potassium permanganate , sodium carbonate , mohr salt , oxalic acid , capillary t...

Due Date : Aug 2, 2024
Tender Value : rupee 5 Lakhs
View Notice
49

Government Departments - Raipur - Chhattisgarh

44154402 e –tender for rate contract of consumable items to chhattisgarh medical services corporation ltd (tender ref. no. 181(r)/cgmscl/consumable/ 1 sfm04 vtm kit 2 nk41 anti hev igm elisa qualitative test kit (any firm/company providing sensitivity and specificity more than 99% with who/gmp /iso/fda certification or niv/cdc recommendation.) 3 nc810 hcv pcr assay kit ready to use molecular detection kit for real time pcr based detection of hepatitis c virus dna. all necessary reagents optimized for re...

Due Date : Jul 25, 2024
Tender Value : Ref. Document
View Notice
50

Government Departments - Raipur - Chhattisgarh

44133853 e –tender for rate contract of consumable items to chhattisgarh medical services corporation ltd (tender ref. no. 172(r )/cgmscl/consumable/ 1 ahsgov antiseptic handrub solution 500ml 2 bck01 blood collection kit (containers,blood collection tubes etc) 3 bct01 blood collection tube (adult) 4 bct02 blood collection tube (pediatric) 5 c135 barium sulphate enema 3.5 kg 6 c17 bone biopsy needle 7 c179 insulin pen needle 8 c188 blood collection tube edta 2ml 9 c189 blood collection tube edta 3ml 10 ...

Due Date : Jul 24, 2024
Tender Value : Ref. Document
View Notice
51

Government Departments - Raipur - Chhattisgarh

44133786 e –tender for rate contract of consumable items to chhattisgarh medical services corporation ltd (tender ref. no. 174(r)/cgmscl/ 1 c172 intra ocular lense(biconvex, u.v. protection/yellow, square edge) 2 c166 intra oculat lense 3 c173 foldable phaco lense (biconvex, u.v. protection/yellow, square edge) 4 c167 foldable phaco lense 5 s25 chormic with cd cutting needle 12 mm length 70 cm size 3 6 s72 synthetic absorbable sutures with 1/2 cir rb needles 20mm length 70 cm size 2/0 7 s46 polydioxane ...

Due Date : Jul 24, 2024
Tender Value : Ref. Document
View Notice
52

Government Departments - Nava Raipur - Chhattisgarh

44132344 e –tender for rate contract of consumable items 1 c172 intra ocular lense(biconvex, u.v. protection/yellow, square edge) 2 c166 intra oculat lense 3 c173 foldable phaco lense (biconvex, u.v. protection/yellow, square edge) 4 c167 foldable phaco lense 5 s25 chormic with cd cutting needle 12 mm length 70 cm size 3 6 s72 synthetic absorbable sutures with 1/2 cir rb needles 20mm length 70 cm size 2/0 7 s46 polydioxane with 1/2 cir round body needle 11mm length 45cm size 6/0 8 s15 catgut chromic le...

Due Date : Jul 24, 2024
Tender Value : Ref. Document
View Notice
53

Government Departments - Nava Raipur - Chhattisgarh

44132286 e –tender for rate contract of consumable items 1 ahsgov antiseptic handrub solution 500ml 2 bck01 blood collection kit (containers,blood collection tubes etc) 3 bct01 blood collection tube (adult) 4 bct02 blood collection tube (pediatric) 5 c135 barium sulphate enema 3.5 kg 6 c17 bone biopsy needle 7 c179 insulin pen needle 8 c188 blood collection tube edta 2ml 9 c189 blood collection tube edta 3ml 10 c19 bone narrow aspiration needle 11 c190 blood collection tube 4ml 12 c191 blood collection...

Due Date : Jul 24, 2024
Tender Value : Ref. Document
View Notice
54

Government Departments - raipur - Chhattisgarh

44126320 rate contract for supply of consumables for abg machine siemens rapidpoint 500 blood gas system rate contract for supply of consumables for abg machine siemens rapidpoint 500 blood gas system at all india institute of medical sciences raipur , consumables under pac for blood gas analyser , all consumables including reagents/ cartridge/paper/electrode per samples

Due Date : Jul 17, 2024
Tender Value : Ref. Document
View Notice
55

Government Departments - Raipur - Chhattisgarh

44111826 e –tender for rate contract of consumable items to chhattisgarh medical services corporation ltd 1 cn51 test tube holder 2 nc1016 dark goggles 3 nc1042 examination torch 4 nc119 beakar 5 nc121 bunsen burner 6 nc122 capillary tube for ct 7 nc125 coplin jar ( glass ) 8 nc126 cover slip 22x22 mm 9 nc128 cuvette for pt (disposable) 10 nc129 enamel tray 18x 12 “ 11 nc130 enamel basin 6 “ 12 nc135 glass container 12x 15 “ 13 nc136 glass marking pencil ( blue and red , white ) 14 nc142 micro slide pi...

Due Date : Jul 23, 2024
Tender Value : Ref. Document
View Notice
56

Government Departments - Raipur - Chhattisgarh

44111525 e –tender for rate contract of consumable items to chhattisgarh medical services corporation ltd c185 2 c186 specimen container stool container 3 c187 storage vial 2ml 4 nc158 urine containert plastic) 500 ml capcity. tips (1000 µl) (co. transasia) (code no 5 nc297 174265)(proprietary item) nc32 micro tips (50 micro liter) 7 nc329 slide box test tube pulypropylene (12 x 75mm) clear transparent and disposable nc671 9 test tube polypropylene (12 x 100mm) clear, transparent and disposable nc672 10...

Due Date : Jul 23, 2024
Tender Value : Ref. Document
View Notice
57

Cooperative - Kabirdham - Chhattisgarh

44083838 invitation of e tender for engineering (paints, nut & bolts, electrical & instrument spares etc. ) (2024 25) 1 chicken net 2 plastic handle wire brush 2.5x8 3 power hexa blead size 1 x 12 make miranda 4 corial rope (coconut rope) 5 metalic self lubrication gland packing size 3mm styl no 1000/1415, each length 06 mtr per box, make champion/spitman/inmarco 6 metalic self lubrication gland packing size 6mm styl no 1000/1415, each length 06 mtr per box, make cham...

Due Date : Jul 23, 2024
Tender Value : Ref. Document
View Notice
58

Government Departments - Raipur - Chhattisgarh

44055729 tender for fully automated chemiluminescence immuno assay analyzer with prenatal screening markers (free of cost)” on reagent rental basis per test wise for 5 years rate contract basis at department of biochemistry .

Due Date : Jul 13, 2024
Tender Value : Ref. Document
View Notice
59

Government Departments - Raipur - Chhattisgarh

44016916 notice inviting tender for fully automated chemiluminescence immuno assay analyzer with prenatal screening markers (free of cost)” on reagent rental basis per test wise for 5 years rate contract basis at department of biochemistry

Due Date : Jul 29, 2024
Tender Value : Ref. Document
View Notice
60

Government Departments - raipur - Chhattisgarh

44012732 supply of reagent kit for uric acid pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number = 100 ml pack) reagent kit for uric acid pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number = 100 ml pack), reagent kit for uric acid pack size 100 ml for microlab 300 semi automated biochemistry anal yzer (1 number = 100 ml pack)

Due Date : Jul 10, 2024
Tender Value : Ref. Document
View Notice
61

Government Departments - raipur - Chhattisgarh

44012720 supply of reagent kit for cholesterol, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number= 100 ml pack) reagent kit for cholesterol, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number= 100 ml pack), reagent kit for cholesterol, end point pack size 100 ml for microlab 300 semi automated bioc hemistry analyzer (1 number= 100 ml pack)

Due Date : Jul 10, 2024
Tender Value : Ref. Document
View Notice
62

Government Departments - raipur - Chhattisgarh

44012700 supply of reagent kit for urea, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number= 100 ml pack) reagent kit for urea, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number= 100 ml pack), reagent kit for urea, end point pack size 100 ml for microlab 300 semi automated biochemist ry analyzer (1 number= 100 ml pack)

Due Date : Jul 10, 2024
Tender Value : Ref. Document
View Notice
63

Government Departments - raipur - Chhattisgarh

44012679 supply of reagent kit for triglyceride, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number = 100 ml pack) reagent kit for triglyceride, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number = 100 ml pack), reagent kit for triglyceride, end point pack size 100 ml for microlab 300 semi automated bioc hemistry analyzer (1 number = 100 ml pack)

Due Date : Jul 10, 2024
Tender Value : Ref. Document
View Notice
64

Government Departments - raipur - Chhattisgarh

44012642 supply of reagent for ldl cholesterol pack size 80 ml for microlab 300 semi automated biochemistry analyzer (1 number=80 ml pack) reagent for ldl cholesterol pack size 80 ml for microlab 300 semi automated biochemistry analyzer (1 number=80 ml pack), reagent for ldl cholesterol pack size 80 ml for microlab 300 semi automated biochemistry a nalyzer (1 number=80 ml pack)

Due Date : Jul 10, 2024
Tender Value : Ref. Document
View Notice
65

Government Departments - raipur - Chhattisgarh

44012641 supply of reagent kit for creatinine, kinetic pack size 240 ml pack for microlab 300 semi automated biochemistry analyzer (1 number = 1 pack of 240 ml) reagent kit for creatinine, kinetic pack size 240 ml pack for microlab 300 semi automated biochemistry analyzer (1 number = 1 pack of 240 ml), reagent kit for creatinine, kinetic pack size 240 ml pack for microlab 300 semi automated bio chemistry analyzer (1 number = 1 pack of 240 ml)

Due Date : Jul 10, 2024
Tender Value : Ref. Document
View Notice
66

Government Departments - raipur - Chhattisgarh

44012602 supply of reagent kit for glucose (god pod/hexo kinase method) pack of 10x200 ml for microlab 300 semi automated biochemistry analyzer (1 number=10x200 ml pack) reagent kit for glucose (god pod/hexo kinase method) pack of 10x200 ml for microlab 300 semi automated biochemistry analyzer (1 number=10x200 ml pack), reagent kit for glucose (god pod/hexo kinase method) pack of 10x200 ml for microlab 300 semi automated biochemistry analyzer (1 number=10x200 ml pack)

Due Date : Jul 10, 2024
Tender Value : Ref. Document
View Notice
67

Government Departments - raipur - Chhattisgarh

44012539 supply of reagent kit for hdl cholesterol direct pack of 160 ml for microlab 300 semi automated biochemistry analyzer (1 number= 160 ml pack) reagent kit for hdl cholesterol direct pack of 160 ml for microlab 300 semi automated biochemistry analyzer (1 number= 160 ml pack), reagent kit for hdl cholesterol direct pack of 160 ml for microlab 300 semi automated bioch emistry analyzer (1 number= 160 ml pack)

Due Date : Jul 10, 2024
Tender Value : Ref. Document
View Notice
68

Boards / Undertakings / PSU - Balodabazar - Chhattisgarh

44002656 supply of reagents, kit, consumables etc for pathology and blood bank.

Due Date : Aug 7, 2024
Tender Value : Ref. Document
View Notice
69

Government Departments - raipur - Chhattisgarh

44000107 tender of two year rate contract for supply of consumables and reagents 2nd call at microbiology department aiims raipur , consumables and reagentsfor microbiology department: , mueller hinton agar (pack size – 1 x 500 g) , nutrient agar (pack size – 1 x 500 g) , cled agar with bromo thymol blue (pack size 1 x 500g) , brain heart infusion broth (pack size 1 x 500g) , peptone water (pack size 1 x 500g) , sabouraud dextrose agar (pack size 1 x 500 g) , triple sugar iron agar (pack size ...

Due Date : Jul 25, 2024
Tender Value : Ref. Document
View Notice
70

Government Departments - raipur - Chhattisgarh

44000085 tender for 5 year reagent rental rate contract for fully automated chemiluminescence immunoassay analyzer for department of biochemistry; 1 5 years rental reagent 2 afp 3 anti ccp 4 anti tpo 5 ca 125 6 ca 19 9 7 cea 8 ckmb 9 cortisol 10 c peptide 11 ferritin 12 folate 13 free beta hcg 14 free psa 15 free t3 16 free t4 17 fsh 18 high sensitivitytroponin i 19 homocysteine 20 inhibin a 21 insulin 22 intact pth 23 lh 24 papp a 25 progesterone 26 prolactin 27 testosterone ...

Due Date : Jul 29, 2024
Tender Value : Ref. Document
View Notice
71

Government Departments - Rajnandgaon - Chhattisgarh

43981061 tender for purchase of reagents, chemicals, surgical materials, test kits, proprietary materials/kits and other consumables to be used in shri atal bihari vajpayee memorial government medical college affiliated hospital, rajnandgaon (chhattisgarh).

Due Date : Jul 30, 2024
Tender Value : Ref. Document
View Notice
72

Government Departments - Rajnandgaon - Chhattisgarh

43978166 tender for the purchase of reagents, chemicals, surgical materials, test kits, proprietary materials/kits and other consumable materials

Due Date : Jul 30, 2024
Tender Value : Ref. Document
View Notice
73

Government Departments - raipur - Chhattisgarh

43852527 supply of reagent for ldl cholesterol pack size 80 ml for microlab 300 semi automated biochemistry analyzer (1 number=80 ml pack) reagent for ldl cholesterol pack size 80 ml for microlab 300 semi automated biochemistry analyzer (1 number=80 ml pack), reagent for ldl cholesterol pack size 80 ml for microlab 300 semi automated biochemistry a nalyzer (1 number=80 ml pack) => limited

Due Date : Jul 2, 2024
Tender Value : Ref. Document
View Notice
74

Government Departments - raipur - Chhattisgarh

43852515 supply of reagent kit for creatinine, kinetic pack size 240 ml pack for microlab 300 semi automated biochemistry analyzer (1 number = 1 pack of 240 ml) reagent kit for creatinine, kinetic pack size 240 ml pack for microlab 300 semi automated biochemistry analyzer (1 number = 1 pack of 240 ml), reagent kit for creatinine, kinetic pack size 240 ml pack for microlab 300 semi automated bio chemistry analyzer (1 number = 1 pack of 240 ml) => limited

Due Date : Jul 2, 2024
Tender Value : Ref. Document
View Notice
75

Government Departments - raipur - Chhattisgarh

43852509 supply of reagent kit for glucose (god pod/hexo kinase method) pack of 10x200 ml for microlab 300 semi automated biochemistry analyzer (1 number=10x200 ml pack) reagent kit for glucose (god pod/hexo kinase method) pack of 10x200 ml for microlab 300 semi automated biochemistry analyzer (1 number=10x200 ml pack), reagent kit for glucose (god pod/hexo kinase method) pack of 10x200 ml for microlab 300 semi automated biochemistry analyzer (1 number=10x200 ml pack) => limited

Due Date : Jul 2, 2024
Tender Value : Ref. Document
View Notice
76

Government Departments - raipur - Chhattisgarh

43852449 supply of reagent kit for triglyceride, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number = 100 ml pack) reagent kit for triglyceride, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number = 100 ml pack), reagent kit for triglyceride, end point pack size 100 ml for microlab 300 semi automated bioc hemistry analyzer (1 number = 100 ml pack) => limited

Due Date : Jul 2, 2024
Tender Value : Ref. Document
View Notice
77

Government Departments - raipur - Chhattisgarh

43852394 supply of reagent kit for urea, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number= 100 ml pack) reagent kit for urea, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number= 100 ml pack), reagent kit for urea, end point pack size 100 ml for microlab 300 semi automated biochemist ry analyzer (1 number= 100 ml pack) => limited

Due Date : Jul 2, 2024
Tender Value : Ref. Document
View Notice
78

Government Departments - raipur - Chhattisgarh

43852386 supply of reagent kit for cholesterol, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number= 100 ml pack) reagent kit for cholesterol, end point pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number= 100 ml pack), reagent kit for cholesterol, end point pack size 100 ml for microlab 300 semi automated bioc hemistry analyzer (1 number= 100 ml pack) => limited

Due Date : Jul 2, 2024
Tender Value : Ref. Document
View Notice
79

Government Departments - raipur - Chhattisgarh

43852371 supply of reagent kit for uric acid pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number = 100 ml pack) reagent kit for uric acid pack size 100 ml for microlab 300 semi automated biochemistry analyzer (1 number = 100 ml pack), reagent kit for uric acid pack size 100 ml for microlab 300 semi automated biochemistry anal yzer (1 number = 100 ml pack) => limited

Due Date : Jul 2, 2024
Tender Value : Ref. Document
View Notice
80

Government Departments - raipur - Chhattisgarh

43852334 supply of reagent kit for hdl cholesterol direct pack of 160 ml for microlab 300 semi automated biochemistry analyzer (1 number= 160 ml pack) reagent kit for hdl cholesterol direct pack of 160 ml for microlab 300 semi automated biochemistry analyzer (1 number= 160 ml pack), reagent kit for hdl cholesterol direct pack of 160 ml for microlab 300 semi automated bioch emistry analyzer (1 number= 160 ml pack) => limited

Due Date : Jul 2, 2024
Tender Value : Ref. Document
View Notice
81

Government Departments - BILASPUR - Chhattisgarh

43816839 subject: reagents for hplc analyzer (arkray adams a1c ha 8180t) for the department of endocrinology on proprietary basis inviting comments thereon

Due Date : Jul 5, 2024
Tender Value : Ref. Document
View Notice
82

Government Departments - Chhattisgarh

43761112 self. shri lakhiram aggarwal smriti, government medical college, raigarh (chhattisgarh) list of chemicals, kits, reagents, glassware and other consumables for the financial year 2023 24 01 anatomy formalin 02 anatomy spirit 03 anatomy neelgeri oil 04 anatomy glycerin 05 anatomy dpx 06 anatomy xylene 07 anatomy glass beaker 08 anatomy volumetricglass pipette 09 physiology acetone 10 physiology surgical spirit 11 physiology acid 12 physiology platelet count diluting fluid 13 physiology eosi...

Due Date : Jul 13, 2024
Tender Value : Ref. Document
View Notice
83

Government Departments - RAIPUR - Chhattisgarh

43753654 bids are invited for laboratory chemicals and insect rearing cages, 1. bhi agar, modified 500gm 1500 grams himedia 2. bhi broth 500gm 1000 grams himedia 3. plate count agar (standard method agar) 500g 500 grams himedia 4. nutrient agar 500g 500 grams himedia 5. nutrient broth 500g 500 grams himedia 6. muller hinton agar 500g 500 grams himedia 7. macconkey agar 500g 500 grams himedia 8. simmaons citrate agar 500g 500 grams himedia 9. mannitol salt agar 500g 500 grams himedia 10. luria bertini br...

Due Date : Jun 20, 2024
Tender Value : Ref. Document
View Notice
84

Government Departments - RAIPUR - Chhattisgarh

43722791 rate contract offer (e bidding) document for supply of lab chemicals, glassware & plastic ware 1 1.4 dioxane gr 2 2 nitro benzene acid 3 2 4 di nitro toluene 4 5 5 dithiodis – 2 nitro benzoic acid 5 acetic acid ar 6 aceto nitril – ar 7 aceto nitril – hplc 8 aceto nitril – spectro (germany) 9 acetone ar 10 acetone – gr 11 acetone – hplc 12 acetone for spectroscopy 13 activated charcoal 14 agar agar bacteriological powder ar 15 alpha naphthol gr 16 ammonium hydroxide gr 17 ammonium molybdate...

Due Date : Jul 14, 2024
Tender Value : Ref. Document
View Notice
85

Boards / Undertakings / PSU - Korba - Chhattisgarh

43683926 tender for purchase of combi coulomat frit karl fischer reagent at o/o s.e. (opn) dspm tps cspgcl, korba east

Due Date : Jul 5, 2024
Tender Value : rupee 1.43 Lakhs
View Notice
86

Boards / Undertakings / PSU - Bilaspur - Chhattisgarh

43675951 tender for supply of chemicals, kits, reagent glassware and other medical materials for various tests used in the laboratory

Due Date : Jul 10, 2024
Tender Value : Ref. Document
View Notice
87

Government Departments - Raigarh - Chhattisgarh

43663667 supply of chemical, kit, reagent and glassware items.

Due Date : Jul 15, 2024
Tender Value : Ref. Document
View Notice
88

Government Departments - Raipur - Chhattisgarh

43650530 tender for purchase of reagent kits 1.t2622g fp, dna oligo, forward primer dna oligonucleotide sequence: ctcaaggtaagagctgtg pack size 1µmole, 2.t2622g rp, dna oligo, reverse first dna oligonucleotide sequence: ctcactacgagaaggatcctga acctc, pack size 1µmole, 3.syber green pcr kit (100), master mix, pack size 100 reactions

Due Date : Jun 18, 2024
Tender Value : Ref. Document
View Notice
89

Boards / Undertakings / PSU - Bilaspur - Chhattisgarh

43639340 tender for supply of chemicals, kits, reagent glassware and other medical materials for various tests used in the laboratory

Due Date : Jul 10, 2024
Tender Value : rupee 90 Lakhs
View Notice
90

Boards / Undertakings / PSU - Durg - Chhattisgarh

43619229 Corrigendum : bids are invited for reagents for hmds 10110700040010 , 10110700040011 , 10110700040012 , 10110700040013 , 101107000400009 total quantity : 18012

Due Date : Jun 27, 2024
Tender Value : Ref. Document
View Notice
91

Statutory Bodies & Commissions/Committees - Bastar - Chhattisgarh

43546840 Corrigendum : bids are invited for lab chemical 2 97 nisp project material ammonium molybdate , nisp project material ammonium chloride , nisp project material ascorbic acid , labchem 4 amino antipyrene c11h13n3o , labchem ammonium sulphate nh4 2so4 , labchem ammonium acetate c2h7no2 , labchem ansa reagent c16h16n2o3 , nisp project material barium perchlorate , labware barium acetate , labchem barium chloride bacl2 , labchem boric acid h3bo3 , nisp project material bromocresol green , labware calcium hydroxi...

Due Date : Jun 24, 2024
Tender Value : Ref. Document
View Notice
92

Government Departments - raipur - Chhattisgarh

43541998 rate contract for supply of consumables, reagents for performing frozen section and tissue processing for cryomicrotome and automatic tissue processor instrument for department of pathology under pac at aiims raipur , consumables items for microbiology department: , cryomatrix gel(6769006) pack size : 4×120ml/bottle , sanosil disifectant (175200) pack size : 5 ltr , cryostat chuck 30 mm (715530) pack size : 1 nos. , waste wax drawer excelsior (8300) pack size : 5 pcs/pack

Due Date : Jun 20, 2024
Tender Value : Ref. Document
View Notice
93

Boards / Undertakings / PSU - raipur - Chhattisgarh

43513534 Corrigendum : rate contract for spares and reagents for hach make analyzers

Due Date : Jun 18, 2024
Tender Value : Ref. Document
View Notice
94

Government Departments - raipur - Chhattisgarh

43501416 notice open tender for rate contract for supply of reagents calibrators control kits for advia centaur xp of siemens notice open tender for rate contract for supply of reagents calibrators control kits for advia centaur xp of siemens for department of biochemistry at aiims raipur , anemia disease state , ferritin ( fer 50t), pack size 50 tests, per pack , ferritin ( fer 250t), pack size 250tests, per pack , folic acid ( fol ba 100t), pack size 100tests, per pack , folic acid ( fol ba 500t), pac...

Due Date : Jun 24, 2024
Tender Value : Ref. Document
View Notice
95

Government Departments - Raipur - Chhattisgarh

43482225 tender for inviting comments/objection (if any) regarding procurement of consumables/reagents for performing frozen section and tissue processing for cryomicrotome & automatic tissue processor instrument for department of pathology & lab medicine in aiims raipur under proprietary article.

Due Date : Jun 1, 2024
Tender Value : Ref. Document
View Notice
96

Boards / Undertakings / PSU - sipat - Chhattisgarh

43481328 procurement of fine chemicals for ntpc telangana stpp. , thorin indicator,gr , xylenol orange,c31h32n2o13s,10gm , oxalic acid,ar/gr/excelar/emparta,500gm , barium perchlorate,ar/gr/excelar/emparta , barium perchlorate,anhydrous,gr,250gm , phenol disulphonic acid,ar/gr/excelar+ , glacial acetic acid,ar , edta disodium salt,ar/gr/excelar/emparta , ammonium chloride,ar,500gm , hydrochloric acid,ar/gr/excelar/emparta , buffer solution,ammonia , sodium meta bisulphite,ar , pyrogallol,ar/gr/excelar/e...

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
97

Government Departments - Surajpur - Chhattisgarh

43447093 Corrigendum : bids are invited for biochemistry reagent kits (q2) total quantity : 11211

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
98

Government Departments - Raipur - Chhattisgarh

43400230 tender for supply of electrophoresis & immunofixation reagent kits for department under pac at all india institute of medical sciences, raipur

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
99

Government Departments - Raipur - Chhattisgarh

43393348 bids are invited for laboratory chemicals media and kits; acetone; sodium nitroprusside sodium citrate sodium phosphate ammonium molybdate ascorbic acid nitric acid millons reagent dinitrobenzene ethyl acetate hi ar ; magnesium ribbons ammonia hexane toluene folin ciocalteus reagent phosphate buffer saline acetic anhydride n 1 naphthyl ethylenediamine potassium ferricyanide 2% orthophosphoric acid picric acid iodine calcium oxalate crystal; total quantity : 230408

Due Date : May 17, 2024
Tender Value : Ref. Document
View Notice
100

Government Departments - Raipur - Chhattisgarh

43390008 rate contract for supply of electrophoresis and immunofixation reagent kit , electrophoresis and immunofixation reagent kits , sas mx sp 10kit, packsize 100test per pack, minimum 4 to 6 months expiry at the time of supplies of product. , kemtrol serum control normal kit; packsize 10x2ml per pack, minimum 4 to 6 months expiry at the time of supplies of product , kemtrol serum control abnormal kit; packsize 10x2ml per pack, minimum 4 to 6 months expiry at the time of supplies of product , sas ...

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice

Tenders By City

Tenders By Authority

Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail