}
  • Home   ›
  •   Indian Tenders   › Tender Notice : 44436753

    • Invitation Of Quotation For Lab Consumables And Kits At All India Institute Of Medical Sciences, Jodhpur, Jodhpur-Rajasthan

    All India Institute Of Medical Sciences has published Invitation Of Quotation For Lab Consumables And Kits At All India Institute Of Medical Sciences, Jodhpur. Submission Date for this Tender is 02-08-2024. Laboratory Equipment Tenders in Jodhpur Rajasthan. Bidders can get complete Tender details and download the document.




    Tender Notice

    44436753
    Invitation Of Quotation For Lab Consumables And Kits At All India Institute Of Medical Sciences, Jodhpur
    Open Tender
    Indian
    Rajasthan
    Jodhpur
    02-08-2024

    Tender Details

    Invitation Of Quotation For Lab Consumables And Kits At All India Institute Of Medical Sciences, JodhpurNo. 1. 998346 Primer Primer Name: BPTT-F Make: Eurofins Standard Oligo Scale: 25 nmol Sequence: CGTCTCTATACTGTCGAGCAATCG Length: 24 bp 2 998346 Primer Primer Name: BPTT-R Make: Eurofins Standard Oligo Scale: 25 nmol Sequence: CGTGCACACCGGTCAGTATC Length: 20 bp 3 998346 Primer Primer Name: BPTT-Probe Make: Eurofins Standard Oligo Scale: 50 nmol Sequence: CCGGAATCTGGATCACCACCACTTTCC Length: 27 bp 4 D1847NZ Ashdown agar Powder 500gm 5 C4461- Colistin sulphate (1G) 6 998346 Primer Primer Name: 32F Make: Eurofins Standard Oligo Scale: 25 nmol Sequence: TCTGGTTCATGCTGGTTTCA Length: 20 bp 7 998346 Primer Primer Name: 32R Make: Eurofins Standard Oligo Scale: 25 nmol Sequence: GGCCGTAATACCAGTTGCTC Length: 20 bp 8 998346 Primer Primer Name: Bc16F Make: Eurofins Standard Oligo Scale: 25 nmol Sequence: TCCTTGGCTCTAATACAGTCGG Length: 22 bp 9 998346 Primer Primer Name: Bc16R Make: Eurofins Standard Oligo Scale: 25 nmol

    Key Value

    Document Fees
    Refer document
    EMD
    Refer document
    Tender Value
    Refer document
    Disclaimer :
    We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
    Tell us about your Product / Services,
    We will Find Tenders for you
    Cnet Technologies

    We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

    About Us

    Services

    Browse Tenders

    For Sales Inquiry

    Connect With Us

    Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

    For Tender Information Services Visit : TenderDetail