}

Bids Are Invited For Sigma Roche Merck Products Mse 4693159001 Protease Inhibitor Cocktail Tablets - Complete Mini Edta Free , T3251-100G , Pcr Primers Scale 50Nmole Bases Desalted , Ufc700308 Centricon Plus 70 Centrifugal Filter 3Kda Cutoff , Sct123 Gelr, MUMBAI-Maharashtra

Department of Health Research has published Bids Are Invited For Sigma Roche Merck Products Mse 4693159001 Protease Inhibitor Cocktail Tablets - Complete Mini Edta Free , T3251-100G , Pcr Primers Scale 50Nmole Bases Desalted , Ufc700308 Centricon Plus 70 Centrifugal Filter 3Kda Cutoff , Sct123 Gelr. Submission Date for this Tender is 15-01-2024. Chemical Supply Tenders in MUMBAI Maharashtra. Bidders can get complete Tender details and download the document.




Tender Notice

41467404
Bids Are Invited For Sigma Roche Merck Products Mse 4693159001 Protease Inhibitor Cocktail Tablets - Complete Mini Edta Free , T3251-100G , Pcr Primers Scale 50Nmole Bases Desalted , Ufc700308 Centricon Plus 70 Centrifugal Filter 3Kda Cutoff , Sct123 Gelr
Open Tender
Indian
Maharashtra
Mumbai
15-01-2024

Tender Details

Bids Are Invited For Sigma Roche Merck Products Mse 4693159001 Protease Inhibitor Cocktail Tablets - Complete Mini Edta Free , T3251-100G , Pcr Primers Scale 50Nmole Bases Desalted , Ufc700308 Centricon Plus 70 Centrifugal Filter 3Kda Cutoff , Sct123 Gelred Nucleic Acid Stain 10000Xwater , Primers For Dv23rrna 23S-1991F 5Ccatctcttgactgtctcggctat3 , Primers 23S- 2138R5cctacctattctctacatggtggtgtt3 , 04793773001 Probe C111, Set Of 2 , 0534462001 Lamp Halogen 12V Power Assay , 4838181001 Ist Deproteinizer , 12172623122 Cfas Lipids Calibrators 3X1ml , 4718917190 Cholestrol For Cobas C111 400 Tests , 11706802001 Assaycup Elecsys2010 Cobas Ey11 3600 , 11706799001 Assay Tip Elecsys 2010 Cobas Ey11 3600 , 4357108001 Curvette Segments Cobas C111 1680 , 4657594190 Triglycerides For Cobas C111 200Tests , 7528604190 Hdl Cholestrol For Cobas C111 200 Tests Total Quantity : 1074

Key Value

Document Fees
Refer document
EMD
Refer document
Tender Value
INR 2.72 Lakhs /-
Disclaimer :
We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
Tell us about your Product / Services,
We will Find Tenders for you

Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail