}
  • Home   ›
  •   Indian Tenders   › Tender Notice : 40515665

    • Tender for Switch Forward Reverse For Secheron, dhanbad-Jharkhand

    East Central Railway has published Tender for Switch Forward Reverse For Secheron. Submission Date for this Tender is 30-11-2023. Switch Supply Tenders in dhanbad Jharkhand. Bidders can get complete Tender details and download the document.




    Tender Notice

    40515665
    Click Here To View Tendering Authority.
    Tender for Switch Forward Reverse For Secheron
    Tender
    Indian
    Jharkhand
    Dhanbad
    30-11-2023

    Tender Details

    Supply Of Switch Forward Reverse For Secheronswitch Forward Reverse For Secheron,Switch Forward Reverse For Secheron Make Master Controller [Drive Direction Selector]. M/S Secheron Id No. Ss460038r0001. Spec./Drg. No. :-As Per Clw Spec. No.-Clw Drg. No. Clw/Es/3/0031/A. [ Warranty Period: 30 Months After The Date Of Delivery ]

    Key Value

    Document Fees
    Refer document
    EMD
    Refer document
    Tender Value
    Refer document
    Disclaimer :
    We takes all possible care for accurate & authentic tender information, however Users are requested to refer Original source of Tender Notice / Tender Document published by Tender Issuing Agency before taking any call regarding this tender.
    1

    Government Departments - kanchrapara

    50071727 supply of switch forward reverse for master controller etc.switch forward reverse for master controller etc.,switch forward reverse for master controller (drive direction selector) for wap 7 & wag 9 (3 phase) loco. as per clws specn. no.

    Due Date : Aug 1, 2025
    Tender Value : Ref. Document
    2

    Boards / Undertakings / PSU - Calicut

    49998651 tender for supply of upf wattmeter with forward backward switch

    Due Date : Jul 21, 2025
    Tender Value : Ref. Document
    3

    Government Departments - chennai

    50053457 supply of procurement of dc contactor for forward reverse application with part no.50023200.procurement of dc contactor for forward reverse application with part no.50023200.,dc contactor for forward reverse application with part no.50023200 or any other

    Due Date : Jul 21, 2025
    Tender Value : Ref. Document
    4

    Government Departments - Gautam Buddha Nagar

    50168232 tender for procurement of chemicals reagents and kits reg; primers for sgrna and puromycin forward & reverse (primer seq. pair attached) note: specification of primer is attached as annexure iii => limited

    Due Date : Aug 4, 2025
    Tender Value : Ref. Document
    5

    Government Departments - Delhi

    50007164 , 6 primers reverse cttcctagccagccggcatc , 7 primers forward ctcctggaagctgatcttagg 21bp , 8 primers reverse cctctctctatctagctccagcc 21bp , 9 primers forward control gccaaacacttcgagcac 18bp , 10 primers reverse control cggctcctggatggcctca 18bp

    Due Date : Jul 26, 2025
    Tender Value : rupee 38 Lakhs
    Tell us about your Product / Services,
    We will Find Tenders for you
    Cnet Technologies

    We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

    About Us

    Services

    Browse Tenders

    For Sales Inquiry

    Connect With Us

    Copyright © 2025 · All Rights Reserved. Terms of Usage | Privacy Policy

    For Tender Information Services Visit : TenderDetail