|
| 1 | Micro glass slide, Frosted-50nos/box, Brand: Blue star/Merck/Thermo Fisher Scientific |
| 2 | Cover slip-100 pc/box, Brand: Generic /Merck/Blue star |
| 3 | Test tubes with cork lid - 15 ml-pack of 10pc, Brand: Generic /Merck/Thermo Fisher Scientific |
| 4 | Test tube holder-brass-Brand: Harpal son/Merck |
| 5 | Volumetric flask with cap- 1000ml, Brand: EISCO/Merck |
| 6 | Volumetric flask with cap--250ml, Brand: EISCO/Merck |
| 7 | Tissue Specimen Jar, Clear transparent glass with lid--Vol:1.2 L, Brand: Borosil/S Science |
| 8 | Glass Beaker (graduated) -- 250ml, Brand: WitegScientific/EISKO/Glassco/Thermo Fisher Scientific |
| 9 | Glass Beaker --500ml, 6pc/pack, Brand: LFAS/Glassco/Thermo Fisher Scientific |
| 10 | Glass Beaker -1000ml, 6 pc/pack, LFAS/Glassco/Thermo Fisher Scientific |
| 11 | Glass Beaker –2000ml, 2pc/pack, LFAS/Glassco/Thermo Fisher Scientific |
| 12 | Conical flask—250 ml, 6pc/pack, LFAS/Glassco/Thermo Fisher Scientific |
| 13 | Polycarbonate aluminum anaerobic culture Jar—3.5 lits, Brand: ALPHA CHEM/Glassco/Thermo Fisher Scientific |
| 14 | Metalic anaerobic culture Jar—3.5 lits, ALPHACHEM/Glassco/Thermo Fisher Scientific |
| 15 | Candle Jar –5 liters, BOROSIL/Glassco/Thermo Fisher Scientific |
| 16 | Homogenizer—100 to 1000 ml, Bionicsscientific/REMI/Glassco/BR Biochem |
| 17 | Magnetic stirrer—Capacity-1liter, REMI/Glassco/Thermo Fisher Scientific |
| 18 | Measuring cylinder –1000ml, LABIFIE/Glassco/Thermo Fisher Scientific |
| 19 | Screw Blue Caped Glass reagent bottle—100 ml, 4 pc/pack, Brand: WitegBorosilicated/ABG/Generic |
| 20 | Diamond Pencil—Brand: Micare India Inc/Glassco/Thermo Fisher Scientific |
| 21 | WintrobesHaematocrit tube –10pc/pack, Brand: MLABS/Glassco/Thermo Fisher Scientific |
| 22 | Haemometer—Brand: MLABS/Glassco/Thermo Fisher Scientific |
| 23 | Haemocytometer—Generic/WKM |
| 24 | Fresh wrap aluminum foil –6mtr Pkt, Brand: Fresh wrap/FRESHMETZ |
| 25 | Micropipette Tips—Capacity /Vol.- 1000 µl, Brand:Tarson/Genaxy/Himedia/Glassco |
| 26 | Micropipette Tips—Neutral Colour Vol.- 200 µl, Brand: Tarson/Genaxy/Himedia/Glassco |
| 27 | MicropipetteTips—Neutral Colour Vol.- 100 µl, Brand: Tarson/Genaxy/Himedia/Glassco |
| 28 | 1-20 µl natural bulk non sterilized Micropipette Tips—1000 tips/pkt, Brand:Genaxy/Thermo Fisher Scientific /Avantor |
| 29 | Micropipette Tips—Vol.:1-10 µl, Brand: Himedia/Tarson/Genaxy/Thermo Fisher Scientific /Avantor |
| 30 | Micropipette Tips—Neutral Colour*Vol.- 0.5-10 µl, Brand: Himedia/Tarson/Genaxy/Thermo Fisher Scientific /Avantor |
| 31 | 100-1000 µl natural bulk beveled non sterilized Micropipette Tips—500 tips/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 32 | 0.5-10µl natural racked low retention non sterilized—10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 33 | 0.5-20µl natural racked non sterilized—0 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 34 | 1-200µl yellow racked beveled non sterilized—10 racks/pk, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 35 | 100-1000µl Blue racked Beveled Non sterilized—10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 36 | Empty racks for Gen tips 200µl—0 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 37 | Empty racks for tips –1000µl, 10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 38 | Empty racks for tips –5ml to 10ml, 10 /pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 39 | Empty Racks for Eppendorf Style Tips—200µl, 10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 40 | Click seal Micro Centrifuge –B- Tube-0.6ml pre sterilized, 10×100, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 41 | Click seal Micro Centrifuge Tube –B non-sterilized, Attached hinged cap, autoclavable, 1.5 ml, 500/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 42 | Click seal Micro Centrifuge Tube—G*Pre sterilized Attached hinged cap, air tight autoclavable, 2.0 ml,Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 43 | Click seal Micro Centrifuge Tube—non sterilized, conical bottom, Attached hinged cap, autoclavable, 5.0 ml,Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 44 | Centrifuge Tube—15 ml, Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 45 | Centrifuge Tube—50ml, Orange Cap,Non sterile, Autoclavable, Brand: Himedia/Genaxy/Thermo Fisher Scientific /Avantor |
| 46 | Sterile Disposable Petri Plates*--Polystyrene, Optically clear, size : 90 mm x 15 mm, 600pc per Pkt, Brand: Himedia/Genaxy/Thermo Fisher Scientific /Avantor |
| 47 | Cryo tubes –vol.1.8 ML(50/Pkt) , Brand: Genaxy/Thermo Fisher Scientific /Avantor |
| 48 | Blue purple nitrile gloves—medium size, 100per pkt, Brand: Kimberly-clark/Ansell |
| 49 | Micropipette 6-Pack Bundle—Single channel, variable, 0.1-2.5µl/0.5-10µl/2-20µl/10-100µl/20-200µl/100-1000µl and Pipette Caousel, Brand: ThermoFisher Scientific/ Eppendorf/Gilson |
| 50 | Parafilm M Roll—125\" Length x 4 width,Brand: Parafilm/Lablink/WKM/Himedia |
| 51 | Parafilm dispenser—Brand: LFAS/Genaxy/Himedia/Glassco |
| 52 | Brown Packaging Paper Roll –0 Inch * 5 Mtr 120 gsm Paper Roll (Set of 1, Brown), Brand: Eco Kraft/Himedia/Glassco |
| 53 | Rubber gloves—00 pcs per box, Brand: Urban Haat/TWENOZ/Himedia |
| 54 | Laboratory mask –100 nos. per box, Brand: KNYA MED/Himedia/Glassco |
| 55 | Test tube stand—3 tier, pc/pack, Brand: Genaxy/Himedia/Glassco |
| 56 | Sample bags (Zipped)—7×10,100 bags per packet, Brand: Bibhu/Genaxy/Himedia/Glassco |
| 57 | Non-absorbent Cotton Wool—Brand: Himedia/Glassco/SR Biotech |
| 58 | Absorbent Cotton Wool—Brand: Himedia/Glassco/SR Biotech |
| 59 | Labeling sticker—A4 size, 100 /pack, Brand: Genaxy/Himedia/Glassco |
| 60 | Filter paper, Students grade—100c, Brand: Genaxy/Himedia/Glassco |
| 61 | Syringe—5 ml,100pc/pack, Brand: Glassco/Meark/BD India Pvt. Ltd/Dispovan |
| 62 | Syringe—2 ml, 100pc/pack, Brand: Glassco/Meark /BD India Pvt. Ltd/Dispovan |
| 63 | Embedding cassettes, Plastic—100 nos./pack,Brand: Harpal sons/Genaxy/Himedia/Glassco |
| 64 | Swab stick—100 pc/Pkt, Brand: Apex International/Himedia/Glassco |
| 65 | Tissue roll—12/Pkt, Brand:Premier/Solimo/ Origami |
| 66 | Kim-wipes—Brand: Kimtech science/BD India Pvt. Ltd |
| 67 | Beaker Tong –12” long , made of Stainless Steel, Brand: COMET/Himedia/Glassco |
| 68 | Autoclavable bio hazardous bag—100pc/pack, Brand: Tarson/Himedia/Glassco |
| 69 | Ice box with chiller—4.7liter, blue lid, Brand: Coleman/Cello/Milton |
| 70 | Spirit lamp, stand and wire combo—Brand: Sciencolab/Genaxy/Glassco |
| 71 | Slide tray—6pc/pack, Brand: Tarson/Genaxy/Himedia/Glassco |
| 72 | Laboratory head caps—50 nos. per box, Brand:Vinayakamart/Genaxy |
| 73 | Sample container –Plastic, 100 pc/box, Brand: Welton/Genaxy/Glassco |
| 74 | Polypropylene wash bottle—250 ml, 2pc/unit, Brand: LABIFIE/Genaxy/Glassco |
| 75 | Cryo- cube box—100 places, 4 pc/pack, Brand: LFAS/Genaxy/Glassco |
| 76 | Inoculation loops—Ni-Cr alloy, 10 Pc/pack, Brand: Generic/Genaxy/Glassco |
| 77 | Slide box—Plastic, 100 slide capacity, Brand: Generic/Glassco |
| 78 | Slide dispenser—Plastic, 50 place, 2 pc/pack,Brand: Tarsons/Glassco |
| 79 | Blood collection tube—With anti-coagulant, blue cap1.8 ml, 100pc/pack, Brand: Next tube/Tar son/BD India Pvt. Ltd. |
| 80 | Mini cooler—For keeping reagents and enzymes. Freeze 00C mini cooler for 24 hours at -50C to -100C, 32 places and capacity 1.5 ml, material- polycarbonate Brand: Borosil/Riviera/Tarson |
| 81 | Sample carrying self-sealing /zip lock poly pouches –600gm (100Pc/Pkt) , Brand: BVSLF |
| 82 | Gloves for OTG/Microwave—One Pair |
| 83 | Silicon Microwave pinch grip—One Pair |
| 84 | Bio Hazard Pedal Dustbin—Green, Yellow and RED, |
| 85 | Romanosky-Giemsa\"sstaining solution—500ml, Brand: Himedia/Sigma-Aldrich |
| 86 | Methylene blue—125 ml bottle, Brand: Merck/Thermo Fisher Scientific/Himedia |
| 87 | Formalin—5liter jar, Brand: ISOCHEM/LABOGEN |
| 88 | Leishmen’sstain—125 ml,Brand: APL/Himedia/Merck |
| 89 | Ethanol—5lit jar, Brand: LABOGENS/Himedia/Merck |
| 90 | Methanol—500 ml, Brand: Quali-Tech/Himedia/Merck |
| 91 | Paraffin wax—Melting temperature:56-60°C, 500 gm container, Brand: LABOGEN/Himedia/Merck |
| 92 | Glycerine—200 gm bottle, Brand: Bhumija Life Sciences/Himedia/Merck |
| 93 | DPX—500ml, Brand: Quali-Tech/Merck/Qualigens |
| 94 | Cedar Wood Oil—250 ml,Brand: AlphaChemika/Himedia/LABOGENS |
| 95 | Xylene—500 ml amber glass bottle,Brand: Himedia/Merck/Glassco |
| 96 | WBC diluting fluid—500ml, Brand: LABOGENS/Himedia/Merck |
| 97 | RBC diluting fluid—500ml, Brand: LABOGENS/Himedia/Merck |
| 98 | Platelet diluting fluid—125ml,Brand: LABOGENS/Himedia/Merck |
| 99 | Mayer\"s Haematoxyline stain—125ml, Brand: Himedia/Merck/BD India Pvt. Ltd. |
| 100 | Harri\"sHaematoxyline stain—125ml,Brand: Himedia/Merck/BD India Pvt. Ltd. |
| 101 | Eosin—2%w/v-125 ml, Brand: Himedia/Merck/BD India Pvt. Ltd. |
| 102 | Eosin Yellow water soluble—25 gram,Brand: Himedia/Merck/BD India Pvt. Ltd. |
| 103 | Hand Sanitizer, liquid hand rub—500ml,X10pc/pkt, Brand: Himedia/Merck/BD India Pvt. Ltd. |
| 104 | Phenyle—5lit jar, Brand: Entergent/Himedia/Merck |
| 105 | Isopropyl alcohol—500 ml,Brand: LABOGENS/Himedia/Merck |
| 106 | Hydrogen peroxide—400ml, Brand: LABOGENS/Himedia/Merck |
| 107 | N/10 Hydrochloric acid—500ml, Brand: ThermoFisher Scientific/Himedia/Merck |
| 108 | Nutrient agar—500gm, Brand:Himedia/Merck/ThermoFisher Scentific |
| 109 | Nutrient broth—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
| 110 | Agar powder, Bacteriological—100gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
| 111 | Blood agar base—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
| 112 | Brain Heart Infusion(BHI) broth—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
| 113 | Brain Heart Infusion(BHI) agar—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
| 114 | Mueller Hinton Agar—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific |
| 115 | Gram’s staining kit With allreagents of Gram’s staining -Brand: Himedia/ Merck/Thermo Fisher Scentific |
| 116 | Capsule Staining Kit—Brand:Himedia/Merck/Thermo Fisher Scentific |
| 117 | Anaerobic blood agar plate—50 plates/Pkt, Himedia/Genaxy/Merck |
| 118 | Ornithine decarboxylase broth—100 gm, Brand:Himedia/Genaxy/Borosil |
| 119 | Carbohydrate fermentation kit-Phenol Red Broth Base—100gms,Sucrose– 25gms, Lactose – 25gms, Maltose – 10gms, Inositol – 10gms, Mannitol – 10gms,Galactose – 10gms, Sorbitol – 10gms, Brand: SRL Pvt. Ltd./Himedia/Merck |
| 120 | IMVIC test kit—5 kits/Pkt Each kit performs 10 tests, Himedia/Merck/Thermo Fisher Scientific |
| 121 | Nitrate reagent discs—Twin pack, 1 vial, 50discs/vial, test Brand:Himedia/Thermo Fisher Scientific /Sigma-Aldrich |
| 122 | Rapid Urease test broth—100gm, Brand: Himedia/Thermo Fisher Scientific /Sigma-Aldrich |
| 123 | Oxidase—100 strips, Brand:Merck/Himedia/S Science |
| 124 | Nutrient Gelatin—100gm, Brand: Himedia/Merck/Thermo Fisher Scientific |
| 125 | Sterile glycerol—(40%) AR grade (500ml), Himedia/Merck/Thermo Fisher Scientific |
| 126 | Peptone water—(25×5ml), Himedia/Merck/Thermo Fisher Scientific |
| 127 | Nitrate broth AR grade—100gm, Himedia/Merck/Thermo Fisher Scientific |
| 128 | PenicillinG—10U/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific |
| 129 | Amoxycillin/Clavulenic acid –20/10 mcg per disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific |
| 130 | Cefotaxime –30 mcg/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific |
| 131 | Cefotaxime—5 mcg/disc,100/vial, Himedia/Merck/Thermo Fisher Scientific |
| 132 | Piperacillin / Tazobactam—30/6 mcg/disc,100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 133 | Amoxicillin/ Sulbactam—30/15 mcg/disc,100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 134 | Ceftriaxone/Tazobactam –30/10 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 135 | Amoxycillin/clauvalenic acid—20/10 mcg/Disc,100discs/vial, Brand: Himedia/Merck/Thermo Fisher Scientific |
| 136 | Amikacin –30 mcg/disc 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 137 | Gentamicin –10 mcg/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific |
| 138 | Streptomycin –10 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 139 | Azithromycin –15 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 140 | Tylosine—15 mcg/dusc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 141 | Sulphamethoxazole—25 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 142 | Tetracycline –30 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 143 | Doxycyclinhydrophloride—30 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 144 | Oxytetracyclin—30 mcg/disc, 100disc/vial, Brand: Himedia/Merck/Thermo Fisher Scientific |
| 145 | Levofloxacin –5mcg/disc, 100discs/vial, Brand: Himedia/Merck/Thermo Fisher Scientific |
| 146 | Ofloxacin –5 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 147 | Ciprofloxacin –5mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 148 | Enrofloxacin—5mcg/disc100discs/vial, Himedia/Merck/Thermo Fisher Scientific |
| 149 | EmeraldAmp® GT PCR Master Mix—800 Rxns(Reactions), Dss Takara/Qiagen/Thermo Fisher Scientific/GCC Biotech |
| 150 | 1 kb DNA Ladder—200Rxns, Brand: Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech |
| 151 | 100 bp DNA Ladder (Dye Plus)—Brand: Qiagen/Biorad/Thermo Fisher Scientific/ GCC Biotech |
| 152 | Ethidium bromide solution—(10mg/ml), 500 µl/pack, Brand: Himedia/Merck/BD Ind Pvt Ltd./ GCC Biotech |
| 153 | Agarose special, High EEO—100gm, Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech |
| 154 | Diluent for DNA Extraction—500ML, Brand:Himedia/Merck/Thermo Fisher Scientific |
| 155 | Molecular Biology Grade Water(NFW)—500ml, Brand:Himedia/Thermo Fisher Scientific/Qiagen |
| 156 | Magnesium chloride for molecular biology—Molecular work, Brand:Sigma-Aldrich/Calbiochem |
| 157 | Gel loading dye(single)—1ml×5/ pkt, Brand:Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech |
| 158 | Taq DNA polymerase—1U/ µl, Brand:Qiagen/Biorad/Thermo Fisher Scientific |
| 159 | 16SrRNA gene Primer For RA--Forward primer—CAGCTTAACTGTAGAACTGC, Reverse primer-- IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech |
| 160 | gyrB Gene primer for RA--Forward primer -- GGCTAAGGCAAGACAAGCTG , Reverse primer—GCAGTTCCTCCTGCAGAGTC, IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech |
| 161 | Ribonuclease Z gene primer--Forward primer—TTACCGACTGATTGCCTTCTAG, Reverse primer--, IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech |
| 162 | TE Buffer 10x—1 Lit,Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech |
| 163 | 16SrRNA gene PCR product sequencing—IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech |
| 164 | Serotype specific strains types serotype—India/ abroad-microbiology Lab |
| 165 | Tris-EDTA buffersolution(pH-8)—100 mL, Sigma-Aldrich/Himedia |
| 166 | GSure® Bacterial Isolation Kit—50 Preparartions, GCC Biotech |
| 167 | 10mM dNTP mix, ultrapure—1000 µl, GCC Biotech |
