Paint Supply Tenders from India

337 Paint Supply tenders are published by various Tendering Authorities & Private companies. 337 live Tender for Paint Supply are available in Paint Supply Tender section You can further filter Paint Supply tenders by Tender Value, Tender Submission Date or Project Location.

1

Boards / Undertakings / PSU - Ahmedabad - Gujarat

43422198 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932,enamel, synth total quantity : 62313

Due Date : May 21, 2024
Tender Value : Ref. Document
View Notice
2

Government Departments - Halisahar - West Bengal

43421572 supply of procurement of pu paints kit consisting of 7 componentsprocurement of pu paints kit consisting of 7 components,pu paints kit consisting of 7 components : (1) two component pu top coat apricot y ellow to ral-0708040 rdsos spec no. m&c/pcn/100/2018, with rdsos amendment no. 1b, (rev 2.0 effec tive from september 2020) as an additional requirement. qty per kit - 48 ltrs. (2)two component pu top coat bl ood red to ral-0303045 spec. no- m&c/pcn/100/2018, with rdsos amendment no. 1b, (rev 2...

Due Date : Jun 12, 2024
Tender Value : Ref. Document
View Notice
3

Statutory Bodies & Commissions/Committees - NASHIK - Maharashtra

43421438 bids are invited for indrox 2526m paint remover total quantity : 10680

Due Date : Jun 8, 2024
Tender Value : Ref. Document
View Notice
4

Government Departments - Parel - Maharashtra

43420260 supply of paint remover (in aerosol container),paint remover (in aerosol container),,paint remover (in aerosol container), in 420ml, to remove pu ,epoxy and acrylic paint coatings , make : darien pgr/55 of anabond make or rustlic/ chemique /fosroc/bostik/loctite/molykot or equivalent. sp ecification: viscosity at 30 degree celsius, brookfield dv-ll plus, adtm-r006 (lso 2555), cps - 8 -15. specific g ravity at 30 degree celsius to be 1.15 to 1.25. please note: 1) uploading of products specificat...

Due Date : Jun 13, 2024
Tender Value : Ref. Document
View Notice
5

Cooperative - sethiyathope - Tamil Nadu

43419642 purchase of paints , purchase of paints note : compulsay attached test, quarantee / performance certificate , metal premier red oxide , achr white , achr black , thinner , purchase of enamel paint note : compulsay attached test, quarantee / performance certificate , azure blue , golden yellow , smoke grey , enamel white , postal red , jade green

Due Date : Jun 1, 2024
Tender Value : rupee 62350.0
View Notice
6

Government Departments - bhopal - Madhya Pradesh

43417106 supply of paint aluminiumpaint aluminium,paint aluminium brushing, bright finishing to is:2339/1963. packing in 4 ltrs. dual containers. (this i tem is reserved for rdso approved sources ) this is shelf life items and should be procured with staggered deli very period . supplier to mention/print date of manufacturing on the item & item to be supplied within 60 days of m anufacture date. [ warranty period: 30 months after the date of delivery ] general stores depot bpl, madhya pradesh 2900.00 li...

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
7

Government Departments - Gorakhpur - Uttar Pradesh

43417064 supply of pu paint kit for lhb shatabdi coaches.pu paint kit for lhb shatabdi coaches.,pu paint kit for lhb shatabdi coaches. as per rdso spec. m&c/pcn/100/2018 with rdsos am ndt. no. 1b (rev.1.0) as an additional requirement (01) pu top coat colour gray (two pack) to ral no. ds-240- 60-05, (in 04 ltr. packing) total quantity per kit=20 ltr. (2) pu top coat colour blue to ral no. ds-260-60-35 (tw o pack) (in 04 ltr. packing) total quantity per kit=16 ltr. (03) pu surfacer, white to ral no. 7001...

Due Date : May 29, 2024
Tender Value : Ref. Document
View Notice
8

Government Departments - bhopal - Madhya Pradesh

43417033 supply of brushes 50 mm.brushes 50 mm.,brushes paint and varnish flat size 50 mm rubber set conforming to is-384 part-1-2012 (sixth revi sion) or latest and bristles to is- 1844/1993 or latest.(1)firm should submit four sample before opening of e-tend er as per rdso instruction otherwise offer will be ignored.(2) item is reserved to be purchased from nsic regd fi rms only. [ warranty period: 30 months after the date of delivery ]

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
9

Statutory Bodies & Commissions/Committees - Ernakulam - Kerala

43416971 bids are invited for purchase of paints total quantity : 480

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
10

Statutory Bodies & Commissions/Committees - Jamnagar - Gujarat

43416798 bids are invited for ars items and paint aqua bond , quick dry steel putty , wet surface putty , safety gloves cloth , abrasive paper 230mmx280mm , paper napkin , dvd , envelope cloth coated 12x16 inch , tube flourescent led cfl , lamp cfl led , paint epoxy alluminium primer , paint coal tar epoxy black , epoxy red oxide primer , paint black heat resistant , paint rfu finishing exterior synthetic dark grey , paint black enamell , paint azure blue , paint alluminium heat resistant , paint olive ...

Due Date : Jun 17, 2024
Tender Value : Ref. Document
View Notice
11

Statutory Bodies & Commissions/Committees - Ernakulam - Kerala

43416768 bids are invited for purchase of paints total quantity : 400

Due Date : Jun 8, 2024
Tender Value : Ref. Document
View Notice
12

Statutory Bodies & Commissions/Committees - Sonitpur - Assam

43416677 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 1000

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
13

Statutory Bodies & Commissions/Committees - Kargil - Jammu And Kashmir

43416330 bids are invited for construction joints lime , pu primer nero flor , pu elastomeric joint sealant , bituminous filler board , bituminous 85 slash 25 , retro reflective glass beads thermoplastic paint total quantity : 1585

Due Date : Jun 10, 2024
Tender Value : Ref. Document
View Notice
14

Government Departments - Jammu - Jammu And Kashmir

43416294 bids are invited for paint pu paint , black paint , white paint , silver piant , metal primer , thinner , putty total quantity : 195

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
15

Statutory Bodies & Commissions/Committees - North 24 Parganas - West Bengal

43414745 bids are invited for supply of nc paints - etch primer with spray reducer_1isto1 , nc lacquer thinner , nc matt white paint , nc glossy white paint , nc golden yellow paint , epoxy primer with hardener_1isto1 , epoxy thinner , epoxy dulldark grey blue _ hardener total quantity : 26725

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
16

Statutory Bodies & Commissions/Committees - Bhandara - Maharashtra

43414500 bids are invited for oleum (t) grade total quantity : 1294

Due Date : May 20, 2024
Tender Value : Ref. Document
View Notice
17

Boards / Undertakings / PSU - Noida - Uttar Pradesh

43414203 bids are invited for opc cement grade 43,cpvc slovent cement,red oxide primer,badarpur sand,fine sand total quantity : 1256

Due Date : May 20, 2024
Tender Value : Ref. Document
View Notice
18

Government Departments - bhavnagar - Gujarat

43413267 supply of paint alluminium for general purpose in [paint alluminium for general purpose in dual containers, conforming to is: 2339-2013 with rdso amendment no. 1a (rev. 01 effective from june-2020) as an additional requirement. note: packing in 20 liters nonreturnable new m.s. drums in two pack system.aluminium paste should be supplied inpolythene bags & suspended in aluminium medium in the ms drums.paint alluminium for general purpose in [paint alluminium for general purpose in dual containers...

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
19

Government Departments - Vijayawada - Andhra Pradesh

43413256 supply of white contrast paint in aerosol can as per bs:6072-81 & bs:5044-73 or latest, packing:400ml net content / 500ml can volume.white contrast paint in aerosol can as per bs:6072-81 & bs:5044-73 or latest, packing:400ml net content / 500ml can volume.,white contrast paint in aerosol can as per bs:6072-81 & bs:5044-73 or latest, packing:400ml net content / 500ml can volume. [ warranty period: 30 months after the date of delivery ]

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
20

Government Departments - ernakulam - Kerala

43412378 supply of approved marine paints , supply of marine grade paints with test certificate. , intergard surface tolerant grey , intertuf 262 red primer , interline 850 white , antifouling interspeed 6200 red/brown , intergard 263 tie coat grey , interthane 138 white pu finish , interbond 201 signal green , interthane 138 opaline green , interthane 138 traffic blue / ultra marine blue pu finish , thinner gta 007 , thinner gta 733 , thinner gta 220 , gp thinner 004

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
21

Statutory Bodies & Commissions/Committees - Jalpaiguri - West Bengal

43412204 bids are invited for bamboo 8 ft mse bamboo 8 ft , cgi sheet , laip , burada , spray paint total quantity : 332

Due Date : Jun 8, 2024
Tender Value : Ref. Document
View Notice
22

Statutory Bodies & Commissions/Committees - Palakkad - Kerala

43412019 bids are invited for olive green paint-shade 294 is: 5 (scamic) , heat resistantal. paint , polyurethane finishing paint-jet black , polyurethane zinc-phospate primer , thinner for polyurethane paint , etch primer to def stan 80- 15 is: 5666 total quantity : 39608

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
23

Government Departments - Durg - Chhattisgarh

43411789 bids are invited for m0711110733 paint-primr: 12744 r. o-zn phosp: grey lght , m0719019904 paint cl-rubber: acidalkali res: black total quantity : 1700

Due Date : Jun 8, 2024
Tender Value : rupee 3.78 Lakhs
View Notice
24

Government Departments - Katihar - Bihar

43410773 bids are invited for itbp head trg items 1 25 brass lancer set with 06 pole and triangle base , venetian fabric cloth satin inspired standard size running meter , jhalar strip as per buyer requirements running meter , decorative ribbon for venetian fabric textured textile , patti for venetian fabric cloth satin inspired patern type embroidered , oxocalcium lime form powder and packing size20 kg , red oxide geru form powder packing size25 kg , agro net green width 2 point5 mtr as per buyer requi...

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
25

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

43410593 bids are invited for paint, rfu, finishing, air drying brushing sprying (q3) total quantity : 7529

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
26

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

43410587 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 13853

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
27

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

43410585 bids are invited for paint, rfu, finishing, air drying brushing sprying (q3) total quantity : 10596

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
28

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

43410574 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 11743

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
29

Boards / Undertakings / PSU - kolkata - West Bengal

43410075 supply of paints for external under water areas for grse ngopv project, yard nos. 3037-40

Due Date : May 21, 2024
Tender Value : Ref. Document
View Notice
30

Government Departments - Thiruvananthapuram - Kerala

43409589 tender for providing aluminum partition in the reception, pharmacy area and internal painting of medical centre at sai lncpe; 1 aluminium works 2 engaging coolie 3 providing aluminium works for doors /partition 4 aluminium for shutters of doors 5 providing 12 mmplpb board lamination on both sides 6 providing glazing in aluminium door 5 mm 7 providing aluminium tubular handle bar 8 painting synthetic enamel paint 9 wall painting with acrylic emulsion two coat

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
31

Government Departments - Jodhpur - Rajasthan

43409491 quotation for consumables (primer kras exon) -1. primer kras exon 2f (gtgtgacatgttctaatatagtca) 2. primer kras exon 2r (gaatggtcctgcaccagtaa) 3. primer kras exon 3f (tcaagtcctttgcccatttt) 4. primer kras exon 3r (tacacaaagaaagccctcccc) 5. primer kras exon 4f (ttgtggacaggttttgaaaga) 6. primer kras exon 4r (agaagcaatgccctctaag)

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
32

Government Departments - mysore - Karnataka

43408986 supply of polyurethane based sealantpolyurethane based sealant,supply of polyurethane based sealant for lhb and vande bharat coaches:- one set consisting of t he following items: 1. primer : sika primer 207 or loctite 8517 or total seal 5028 or 3m or eq uivalent- 2 ltrs 2. adhesive: sika flex 265 or henkel (teroson pu 8590) or total seal (so udaflex 621) or 3m (pu 540)- 29.4 litres 3. 01 nozzle and silicone sealant gun suitable to apply the above adhesive note:- 1. the primer and adhesive shoul...

Due Date : Jun 5, 2024
Tender Value : Ref. Document
View Notice
33

Government Departments - lallaguda - Telangana

43408647 supply of full gloss polyurethane enamel (two pack) for the exterior finishing paint of railway coaches conforming to rdso spec.no.m&c/pcn/100/2018, chapter - v with amendment no. 1b (rev-2.0), blood red colour to ral shade card no. 0303045. packing condition : the material to be supplied in two-pack in ratio of 4:1 i.e. 16liters for enamel and 4liters for hardener (total 20liters supply).full gloss polyurethane enamel (two pack) for the exterior finishing paint of railway coaches conforming to...

Due Date : May 31, 2024
Tender Value : Ref. Document
View Notice
34

Government Departments - Chennai - Tamil Nadu

43408614 supply of enamel, interior finishing paintenamel, interior finishing paint,enamel, interior finishing paint synthetic type to specification is:133- 2013 and to icf/specn.icf/m/d/spec.052, issue status-02 revision-01 smoke grey colour code no.isc-692 of is:5-2007(reaffirmed 2017). [ warranty period: 30 months after the date of delivery ] furnishing tamil nadu 2811.00 litre => limited

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
35

Government Departments - Dahod - Gujarat

43408613 supply of paint enamel interior finishing whitepaint enamel interior finishing white,paint enamel interior finishing white to is 133/04 along with additional req uiremenys stipulated in icf specification icf /md/specx.052 issue status 02 rev 01 pack ed in 20 litres in new and sound non returnable ms drums specn: is: 133/04, is:2552/89gra de b-1 note-material must have supplied along with test cerificates otherwise rejected. [ warranty period: 30 months after the date of delivery ] senior sectio...

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
36

Government Departments - ajmer - Rajasthan

43408611 supply of pu paint top coat in (two pack) chapter v to rdso spec. no. m&c/pcn/100/2018 & amendment no. 1b as an additional requirement . colour shade cream ral 9001pu paint top coat in (two pack) chapter v to rdso spec. no. m&c/pcn/100/2018 & amendment no. 1b as an additional requirement . colour shade cream ral 9001,pu paint top coat in (two pack) chapter v to rdso spec. no. m&c/pcn/100/201 8 & amendment no. 1b as an additional requirement . colour shade cream ral 9001. carriage stores depot r...

Due Date : May 28, 2024
Tender Value : Ref. Document
View Notice
37

Government Departments - Ponmalai - Tamil Nadu

43408545 supply of paint remover in aerosol form in suitable packing of net weight 493gm/500ml. it should be less acidic, non- corrosive and non-inflam mable satisfying the is: 430/1972. makes: aerol / stanvac / chemverse / zenith/ aerolube / cvc armlean (ps). note: 1) firm must mention the mak e of the offered material while participating in the tender. 2) one sample should be got approved before effecting bulk supply [ warranty period: 30 m onths after the date of delivery ] => limited

Due Date : May 21, 2024
Tender Value : Ref. Document
View Notice
38

Government Departments - Dahod - Gujarat

43408368 supply of p.u.paint kit for memu coach(consisting five items) to rdso/specn. no. m&c/pc n/100/2018 as given below- (1) pu paint,colour-pale cream to isc-352 of is-5/1994(two pack syste m)rdso spec.no-m&c/pcn/100/2018 with rdsos amendment no. 1b(rev. 2.0 effective from sept.2020 as a n additional requirement) total qty. per kit 18 ltrs (2) pu paint,colour-air craft blue finish t o isc108 to is-5/1994 (two pack system) rdso spec.no-m&c/pcn/100/2018 with rdsos amendment no. 1b(rev. 2.0 effective ...

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
39

Government Departments - Rajpura - Punjab

43405052 tender for providing wall painting of scheme information with enamel paint in various villages under water supply and sanitation sub division banur at rajpura.

Due Date : May 22, 2024
Tender Value : rupee 50000.0
View Notice
40

Government Departments - Prayagraj - Uttar Pradesh

43404840 tender for supply of paint aluminium brushing, cylindrical roller bearing., end ring for zirconium type shaft mounted design rotor surge arrestor, led based twin head light, set of 12.5 watt led light, pulse prob comb, main transformer 7775 kva

Due Date : Jun 24, 2024
Tender Value : Ref. Document
View Notice
41

Government Departments - Ramachandrapuram - Andhra Pradesh

43404801 bids are invited for spirit based zircon paint ready mixed total quantity : 12000

Due Date : May 20, 2024
Tender Value : Ref. Document
View Notice
42

Statutory Bodies & Commissions/Committees - Nashik - Maharashtra

43404670 bids are invited for paint silver aluminium star heatex 400c total quantity : 100

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
43

Government Departments - Ranipur - West Bengal

43404437 bids are invited for wood primer brown colour as per spec is3536 total quantity : 100

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
44

Government Departments - Tirupati - Andhra Pradesh

43403946 supply of supply of paint as set for applying on the axlesupply of paint as set for applying on the axle,supply of paint as set for applying on the axle of vande bharath wheel sets to the following specific ations 1.primer arkote 31, ndft 75-90 microns,qty 25 kgs 2.top coat arkote 31, ral 7016, br 40-70, n dft 110 microns qty 25 kgs 3.hardener durcisseur arkote31 qty 12 kgs 4.thinner diluant t2506 qty 25 ltrs 5.degreasing thinner qty 25 ltrs [ warranty period: 30 months after the date of delive...

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
45

Government Departments - mysore - Karnataka

43403939 supply of paint anti corrosive bituminous black to specn. no.is:9862/81 with amendment 1 of july 1988 (reaffirmed 2009), packed in new steel drums plain in (non-returnable) 20 ltrs capacity to is:2552/89 (reaffirmed 2018) with amendment no.1 grade-b2paint anti corrosive bituminous black to specn. no.is:9862/81 with amendment 1 of july 1988 (reaffirmed 2009), packed in new steel drums plain in (non-returnable) 20 ltrs capacity to is:2552/89 (reaffirmed 2018) with amendment no.1 grade-b2,paint an...

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
46

Local Bodies - dadar - Maharashtra

43403150 synthetic enamel paint shade saffron yellow , items : , synthetic enamel paint shade saffron yellow

Due Date : Jun 3, 2024
Tender Value : Ref. Document
View Notice
47

Government Departments - TUTICORIN - Tamil Nadu

43402971 bids are invited for epoxy based zinc phosphate primer (two pack) epoxy based zinc phosphate primer (two pack) as per is 13238 (q3) mse total quantity : 200

Due Date : May 27, 2024
Tender Value : rupee 67000.0
View Notice
48

Government Departments - mumbai - Maharashtra

43402677 supply of paint ready mixed, brushing red oxidepaint ready mixed, brushing red oxide,paint ready mixed, brushing red oxide zinc chrome priming to is:2074)- (reaffirmed-2020) for exterior with additional requirements as per icf spec. no. icf/md/spec-045 issue status-02, rev-03 and rd so amdt. no. 1a rev. 1.0 as an additional requirement. wet capacity 22 sq. mtr. per ltr. packing in 20 ltrs. new, non-returnable m.s. drum to is:2552-1989 (reaffirmed-2018), gr. b-2. [ warranty period: 30 months aft...

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
49

Government Departments - Hazira - Gujarat

43401517 tender for 2000152886 -spr:gal are structures and guard paintin 2000152886 10 10 10 scraping of old paint & surface cleaning 6,000 m2 20 p & a 1 coat of epoxy primer & 2 coat of 6,000 m2 email : kalpesh.bhojani@amns.in contact : 9879102538 name : kalpesh, bhojani - am/ns india - crm - m item details : spr:gal are structures and guard paintin scope of work for vendor: 1.surface preparation by power tool, cleaning of all structure parts parts (column and beam).after power tool cleaning surface cl...

Due Date : May 26, 2024
Tender Value : Ref. Document
View Notice
50

Government Departments - jhansi - Uttar Pradesh

43401127 bids are invited for matching thinner for epoxy paint primer spec. tre168166 total quantity : 900

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
51

Government Departments - bhopal - Madhya Pradesh

43400915 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) mse total quantity : 800

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
52

Government Departments - ALWAR - Rajasthan

43400683 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) total quantity : 50

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
53

Government Departments - thiruvananthapuram - Kerala

43400521 tender for supply of black finishing paint(manufacturers only)=> limited

Due Date : Jun 1, 2024
Tender Value : Ref. Document
View Notice
54

Government Departments - jhansi - Uttar Pradesh

43399898 supply of paint enamel synthetic exterior brushing finishing golden yellow to is:8662/2004,iind revision or l atest.isc no. 356 to is: 5/1994, gloss 86 and above, wet opacity 12 sq. mtrs. per ltr. packing in 20 ltrs. new no n returnable m.s. drums to is:2552/89 or latest. gr. b-ii. [ warranty period: 12 months after the date of delivery ] gsd/jhs, ncr uttar pradesh 3464.00 litre => limited

Due Date : Jun 3, 2024
Tender Value : Ref. Document
View Notice
55

Government Departments - jhansi - Uttar Pradesh

43399827 supply of paint ready mixed, red oxide (isc:446), brushing finishing, glossy for general purposes to rdso specification no. :m&c/pcn/122/2006. packing in 20 ltrs. new non returnable m.s. drums to is:2552/89 gr.b-ii. [ warranty period: 12 months after the date of delivery ] gsd/jhs, ncr uttar pradesh 27003.00 litre

Due Date : Jun 18, 2024
Tender Value : Ref. Document
View Notice
56

Government Departments - Ajmer - Rajasthan

43396937 supply of :paint black japan type -b to is : 341/2016 with additional requirements of icf/md/spec-052 issue status :02, rev. 01:paint black japan type -b to is : 341/2016 with additional requirements of icf/md/spec-052 issue status :02, rev. 01,:paint black japan type -b to is : 341 / 2016 with additional requirements of icf / md / spec-052 is sue status :02, rev. 01 [ warranty period: 12 months after the date of delivery ] carriage stores depot rajasthan 4000.00 litre

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
57

Government Departments - Sabarmati - Gujarat

43396871 supply of r/m paint synthetic enamelr/m paint synthetic enamel,r/m paint synthetic enamel, exterior,finishing, color: gulf red [isc: 473] for railway coaches, conf orming to is:8662/2004 (second revision) and rdso amendment no. 1 (revision. 0) for pigment content as an additional requirement to is: 8662/2004 w.e.f.01/08/2016 with additional requirements of icf/md/spec.-045 issu e status: 02, rev.no.-03 dt.14/06/2007 and rdsos amendment no. 1a (rev. 1.0,effective fromjune-2020) as a n additional...

Due Date : May 24, 2024
Tender Value : Ref. Document
View Notice
58

Government Departments - perambur - Tamil Nadu

43396832 supply of enamel, synthetic, exterior,finishing,`blackenamel, synthetic, exterior,finishing,`black,enamel, synthetic, exterior,finishing,`black to spec. is:8662/04 (ra-2019) or the latest and icf/ md/spec- 045, issue status 2, rev.03 with amdt. dt. 22/4/2008 or the latest. packing condition- packed in20 liter s new, sound and non-returnable ms drums to is 2552/89 (ra -2018) with amdt.no.1 gr.b2 [ warranty perio d: 12 months after the date of delivery ]

Due Date : May 21, 2024
Tender Value : Ref. Document
View Notice
59

Government Departments - ghaziabad - Uttar Pradesh

43396759 supply of enamel synthetic, exterior, finishing, white. specification:- is:8662/2004 (second rev.)(reaffirmed 2019)enamel synthetic, exterior, finishing, white. specification:- is:8662/2004 (second rev.)(reaffirmed 2019),enamel synthetic, exterior, finishing, white. specification:- is:8662/2004 (second rev.)(reaffirme d 2019) and rdso amendment no. 1(revision. 0) for pigment content as an additional requirement to is:8662/2 004 w.e.f. 01.08.2016 with additional requirements of icf/md/spec.-045,...

Due Date : May 21, 2024
Tender Value : Ref. Document
View Notice
60

Statutory Bodies & Commissions/Committees - Jaipur - Rajasthan

43396648 bids are invited for 4fx5xgx6h white paint brill ashine , yellow paint , op red paint , black paint , brown dark paint , brown golden paint , blue paint , gray paint , chocolate brown paint , og paint , maroon paint , green paint bus , golden paint oil , golden water , selver paint total quantity : 215

Due Date : Jun 6, 2024
Tender Value : Ref. Document
View Notice
61

Government Departments - Gonda - Uttar Pradesh

43396470 bids are invited for grey powder coating paint (ral 7035 structure) mse total quantity : 16320

Due Date : Jun 6, 2024
Tender Value : Ref. Document
View Notice
62

Statutory Bodies & Commissions/Committees - Gurdaspur - Punjab

43396321 bids are invited for boq 1 chunna , teracota , green terecota , geru , yellow paint , blue paint , white paint , red paint total quantity : 99

Due Date : Jun 6, 2024
Tender Value : Ref. Document
View Notice
63

Statutory Bodies & Commissions/Committees - Srinagar - Jammu And Kashmir

43396277 bids are invited for paint, rfu, finishing, air drying brushing sprying (q3) total quantity : 2652

Due Date : May 27, 2024
Tender Value : Ref. Document
View Notice
64

Government Departments - thiruvananthapuram - Kerala

43395215 tender for supply of oxford blue paint(manufacturers only)=> limited

Due Date : Jun 1, 2024
Tender Value : Ref. Document
View Notice
65

Government Departments - thiruvananthapuram - Kerala

43395212 tender for supply of feroxi blue finishing paint(manufacturers only)=> limited

Due Date : Jun 1, 2024
Tender Value : Ref. Document
View Notice
66

Government Departments - thiruvananthapuram - Kerala

43395208 tender for supply of golden yellow enamel paint (manufacturers only => limited

Due Date : Jun 1, 2024
Tender Value : Ref. Document
View Notice
67

Government Departments - Chandrapur - Maharashtra

43395121 Corrigendum : tender for epoxy acrylic paint opening date extension from 16 may 2024 to 22 may 2024

Due Date : May 22, 2024
Tender Value : rupee 6.25 Lakhs
View Notice
68

Private Organizations - Kerala

43395094 tender for supply of paint

Due Date : May 21, 2024
Tender Value : Ref. Document
View Notice
69

Statutory Bodies & Commissions/Committees - Chandigarh - Chandigarh

43394518 bids are invited for polyurethane coatin , polyurethane gunship bla , epoxy primer coating kit mse total quantity : 12

Due Date : Jun 7, 2024
Tender Value : Ref. Document
View Notice
70

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

43394402 bids are invited for paint rfu, air drying (brushingspraying) golden yellow isc-356 (n8010-007494) , paint rfu priming red oxide of fe & zn chromate syn. brushin (n8010-000110) , white spirit (n8010-000131) , putty white (n8010- 000288) , hardner hy-951 (adhesive synth hetic resin hardner) (n8040-000020) , lime slaked (n6840-000002) , solder, non corrosive rosin cored wire (tin alloy) 2.50mm (n3439-000190) , pigment altramine blue (n6810- 000568) , water proof emery paper 180 (9 x11 ) (n0461-12...

Due Date : Jun 6, 2024
Tender Value : Ref. Document
View Notice
71

Statutory Bodies & Commissions/Committees - Jaipur - Rajasthan

43393085 bids are invited for b3c4d5 melamine polish , chock powder , pop , wall pulti acrylic , sprit , nc thinner , tarpin oil , painting brush writing two four sixh twelve , flat brush eight ten twelve , painting brush twenty fivemm , painting brush fifty mm , painting brush seventy five mm , painting brush hundred mm , putti filler three inch six inch nine inch , malmal cloth , water colour thirty ml intu twelve , terricota , oil bond distemper , appex interiar white , appex exteriar white , stainer...

Due Date : Jun 6, 2024
Tender Value : Ref. Document
View Notice
72

Statutory Bodies & Commissions/Committees - Tiruppur - Tamil Nadu

43392580 bids are invited for yellow epoxy primer , 2k moon blue paint , paint flurecent rocket red , paint acrylic dark green , thinner for pv top coat , pv golden yellow , pu paint black , paint pu white , paint hardner , paint pu saffron , pu paint blood red , pu paint mint green , south tuf pu thinner , polyster putty , paint remover , epoxy thinner mse total quantity : 231

Due Date : Jun 6, 2024
Tender Value : Ref. Document
View Notice
73

Statutory Bodies & Commissions/Committees - Hyderabad - Telangana

43392408 bids are invited for raw material for ldam coating vinyl silicone resin , hollow glass microspheres , organo platinum catyalyst , xylene , acetone , blue adhesive primer total quantity : 164

Due Date : Jun 6, 2024
Tender Value : Ref. Document
View Notice
74

Government Departments - jagadhri - Haryana

43391263 supply of supply and application of primer & paintsupply and application of primer & paint,supply and application of primer & paint on complete fiat bogies as per scope of work [ warranty period: 30 months after the date of delivery ]

Due Date : May 30, 2024
Tender Value : Ref. Document
View Notice
75

Government Departments - hyderabad - Telangana

43390674 tender for procurement of paints for use at aws, bhp. – reg.

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
76

Government Departments - Lucknow - Uttar Pradesh

43389656 supply of kit of pu paintskit of pu paints,kit of pu paints (two pack) for lhb rajdhani - coaches. detailed description is as per attached annexure - a . [ warranty period: 30 months after the date of delivery ] dy.cmmamv/lko, nr uttar pradesh 544.00 set

Due Date : Jul 3, 2024
Tender Value : Ref. Document
View Notice
77

Government Departments - pune - Maharashtra

43389626 armcoat 100 paint , armcoat 100 paint , cleaning solutions (cleanol) , dilutor (thinner)

Due Date : May 21, 2024
Tender Value : Ref. Document
View Notice
78

Statutory Bodies & Commissions/Committees - lucknow - Uttar Pradesh

43389494 tender for zone work for year 2024-25 in sector-b, quarter no. b-1 to b-188,a-1, sse/sector-b office, sewerage pump house ,rcc over head tanks and kvs, providing & applying spray applied supplying and applying asian paints ultron/ chryso struco latex/equivalent high performance hybrid polyurea elastomeric waterproof coating spray applied. smartcare ultron liquid membrane with an elongation of 600% and tensile strength of 12.6 n/mm2 as per astm d 2370, crack bridging ability of 3.5 mm as per ast...

Due Date : Jun 10, 2024
Tender Value : rupee 1.85 Crore
View Notice
79

Government Departments - Ajmer - Rajasthan

43387466 supply of pu painting kit for apricoat yellow and blood red pu paints consists of five item 1:-pu paint beige finish ( two pack ) colour shade ral 0708040 to chapter v of rdso spec. no. m&c/pcn/100/2018 amndt. 1b. qty. per kit 44 ltrs. 2:- pu paint maroon finish ( two pack ) colour shade ral 0303045 to chapter v of rdso spec. no. m&c/pcn/100/2018 amndt. 1b.qty. per kit 05 ltrs. 3:- pu surface white ( two pack ) chapter iv of rdso spec. no. m&c/pcn/100/2018 amndt. 1b.qty. per kit 34 ltrs. 4:-thi...

Due Date : May 20, 2024
Tender Value : Ref. Document
View Notice
80

Government Departments - perambur - Tamil Nadu

43387464 supply of paint remover (in aerosol container)paint remover (in aerosol container),paint remover (in aerosol container), in 420ml, to remove pu ,epoxy and acrylic paint coatings darien pgr/55 of anabond make or rustlic/ chemique /fosroc/bostik/loctite/molykot or equivalent. viscosity at 30 degree celsius, brookfield dv-ll plus,adtm-r006 (lso 2555), cps - 8 -15. specific gravity at 30 degree cels ius to be 1.15 to 1.25. please note: uploading of products specification/ catalogue by bidders is ma...

Due Date : Jun 5, 2024
Tender Value : Ref. Document
View Notice
81

Government Departments - Byculla - Maharashtra

43387278 supply of paint salicylic acid 16.7% + lactic acid 16.7%paint salicylic acid 16.7% + lactic acid 16.7%,solution./paint/liquid salicylic acid 16.7% + lactic acid 16.7% => limited

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
82

Statutory Bodies & Commissions/Committees - Jamnagar - Gujarat

43387103 bids are invited for trimgard 15mb red paint total quantity : 5

Due Date : Jun 6, 2024
Tender Value : Ref. Document
View Notice
83

Statutory Bodies & Commissions/Committees - Mumbai - Maharashtra

43386992 bids are invited for wood polish total quantity : 40

Due Date : Jun 5, 2024
Tender Value : Ref. Document
View Notice
84

Statutory Bodies & Commissions/Committees - Jamnagar - Gujarat

43386805 bids are invited for jotun paints penguard primer red jotun , paint hardtop xp white , thinner no 10 , paint hardtop xp green , jotomastic 80 grey , jotomastic 80 aluminium total quantity : 360

Due Date : Jun 5, 2024
Tender Value : rupee 1.90 Lakhs
View Notice
85

Government Departments - Tapi - Gujarat

43386636 bids are invited for enamel, synthetic, exterior (a) under coating (b) finishing paint (v2) as per is 2932 (q3) , thinner for cellulose nitrate based paints and lacquers (q3) total quantity : 60

Due Date : May 25, 2024
Tender Value : Ref. Document
View Notice
86

Government Departments - Uttara Kannada - Karnataka

43385791 bids are invited for aerosol paint blue paint , band , tape , aerosol paint , pol , gloves , mek , gloves s total quantity : 315

Due Date : Jun 5, 2024
Tender Value : Ref. Document
View Notice
87

Government Departments - prayagraj - Uttar Pradesh

43385515 supply of tailless unit and copper strip etc. for business plan 2024-25, phase-2, in edc-ii, prayagraj , item details , henley type tailless unit 300 amps. 650 volts conforming to henley standard manufactured from 18 swg ms sheet duly painted with two coats grey enameled paint with one coat red primer. the ms sheet having 7 holes suitable for 6 nos. top & bottom insulator and one hole for neutral. the top & bottom insulator should be fitted by 6 nos. hexagonal clamps with 6 nos. brass sheet for...

Due Date : May 20, 2024
Tender Value : rupee 31.30 Lakhs
View Notice
88

Boards / Undertakings / PSU - Barnala - Punjab

43385504 tender for purchase of 1. food items (dry ration) 2. fresh fruits and vegetables 3. bakery items 4. student and office stationery 5. dyes and paint materials 6. daily use items 7. washing and ironing clothes 8. shoes and slippers etc.

Due Date : Jun 6, 2024
Tender Value : Ref. Document
View Notice
89

Statutory Bodies & Commissions/Committees - Porbandar - Gujarat

43384902 bids are invited for international paint interguard 561 green total quantity : 180

Due Date : Jun 5, 2024
Tender Value : Ref. Document
View Notice
90

Government Departments - Kharagpur - West Bengal

43384474 supply of supply of alkyd modified synthetic enamel, uv resistant, high gloss and colour retention, grass green (isc no. 218),supply of alkyd modified synthetic enamel, uv resistant, high gloss and colour retention, grass green (isc no. 218),,alkyd modified synthetic enamel, uv resistant, high gloss and colour retention, grass green (isc no. 218), exterior finishing. matl. & spec. : is: 8662 / 2004 with additional requirements of (1) rdso amend. no . 1 (rev. 0) for pigment content to is: 8662 /...

Due Date : Jun 4, 2024
Tender Value : Ref. Document
View Notice
91

Government Departments - jhansi - Uttar Pradesh

43383951 supply of paint aluminium brushing.paint aluminium brushing.,paint aluminium brushing, bright finishing for general purposes to is:2339/1963 [reaffirmed 2009]. packing in 4 ltrs. dual containers [aluminium paste packed in polythene bags and dipped in 4 ltrs container]. [ wa rranty period: 12 months after the date of delivery ] gsd/jhs, ncr uttar pradesh 13172.00 litre

Due Date : Jun 24, 2024
Tender Value : Ref. Document
View Notice
92

Statutory Bodies & Commissions/Committees - kankinara - West Bengal

43383875 spare part of lm ord , steel bar carbon h/rr/bar dia 12 mm , steel bar carbon h/rr/bar dia 8 mm , rubber gromet (as per drawing ) , plain washer (as per drawing) , steel rivet dia 4 mm , paint primer red oxide , steel bar carbon h/r flat 40 x 4 mm , steel 40c8 hex bar 32 mm a/f to is : 157 , bolt with nut m6 x 1 mm to is : 1364- (p , steel bar carbon h/r flat 40 x 6 mm , steel mild sheet c/r 188x900x3.15 mm to , hex bolt with nut ( as per org. sample) , welding electrode ms g./ dia 2.5 mm to i ...

Due Date : May 21, 2024
Tender Value : Ref. Document
View Notice
93

Statutory Bodies & Commissions/Committees - kankinara - West Bengal

43383873 spare part of lm ord , steel bar carbon h/r flat 40x4 mm part no nk , paint primer red oxide part no nk => limited

Due Date : May 21, 2024
Tender Value : Ref. Document
View Notice
94

Government Departments - mysore - Karnataka

43383685 supply of paint enamel synthetic exterior white type i finishing to to is: 8662/2004,rev 2 (reviewed in 2019), along with additional requirements stipulated in icf specification icf/md/specn -045, issue status-02, revision-03 dated. 14-06-2007 and rdsos amendment no.1b as an additional requirement, packed in 20 litres capacity new and sound non-returnable m.s drums to is: 2552/89 (reviewed in 2018) revision 3 and amendment no.1, grade b2.paint enamel synthetic exterior white type i finishing to...

Due Date : May 23, 2024
Tender Value : Ref. Document
View Notice
95

Statutory Bodies & Commissions/Committees - Kupwara - Jammu And Kashmir

43383538 bids are invited for paint, rfu, finishing, air drying brushing sprying (q3) , geru red ochre (q4) , lime (q3) , paint brushes (q3) mse total quantity : 426

Due Date : May 22, 2024
Tender Value : Ref. Document
View Notice
96

Government Departments - Koraput - Odisha

43383410 bids are invited for black paint black paint , blue paint , white paint , olive green paint , yellow paint total quantity : 226

Due Date : Jun 5, 2024
Tender Value : rupee 5 Lakhs
View Notice
97

Government Departments - Nagpur - Maharashtra

43383325 bids are invited for setting up of kidney transplant unit at aiims nagpur 2 59 supply laying and termination of xlpe aluminium armored cable , supplying and laying of gi perforated cable trays , supply and laying of raceway , supply and fixing of switch socket as per the specifiaction , providing and laying cat six pair cable with all necessary accessories , supply and fixing of four way tpn horizontal db box with all accessories , supply and fixing ofisolator , supply and fixing of rccb , supp...

Due Date : Jun 5, 2024
Tender Value : rupee 1 Crore
View Notice
98

Statutory Bodies & Commissions/Committees - Kanpur - Uttar Pradesh

43381718 bids are invited for high heat resistance stoving enamel mse total quantity : 13

Due Date : Jun 5, 2024
Tender Value : Ref. Document
View Notice
99

Statutory Bodies & Commissions/Committees - Jammu - Jammu And Kashmir

43381711 bids are invited for agl bunker specification of agl bunker , super structure and store list , paint items , construction material , erection tools total quantity : 30

Due Date : Jun 5, 2024
Tender Value : Ref. Document
View Notice
100

Statutory Bodies & Commissions/Committees - Kolkata - West Bengal

43381684 bids are invited for brass pressing blanks to drg no 18961g for primer 1al magazine to drg no qx-1709 dc 36123-a total quantity : 4086

Due Date : May 30, 2024
Tender Value : Ref. Document
View Notice
Tell us about your Product / Services,
We will Find Tenders for you
Top
Cnet Technologies

We are a group of professionals specializing in custom software development, web development, mobile app development, IOT base solutions, web design, graphics & Enterprise solutions provid.

About Us

Services

Browse Tenders

For Sales Inquiry

Connect With Us

Copyright © 2024 · All Rights Reserved. Terms of Usage | Privacy Policy

For Tender Information Services Visit : TenderDetail